Amauropelma krabi S. Li & Yao, 2022
|
publication ID |
https://dx.doi.org/10.3897/BDJ.10.e96003 |
|
publication LSID |
lsid:zoobank.org:pub:2A9D4A67-DC00-40DC-9745-BF531D767F55 |
|
persistent identifier |
https://treatment.plazi.org/id/C5E9E60C-A668-5AE7-A9FF-89D05F8A8027 |
|
treatment provided by |
|
|
scientific name |
Amauropelma krabi S. Li & Yao |
| status |
sp. n. |
Amauropelma krabi S. Li & Yao sp. n.
Materials
Type status: Holotype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: female; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Amauropelma ; Location : country: Thailand; stateProvince: Krabi; verbatimLocality: Ao Luk District , Klang Cave ; verbatimElevation: 36 m a.s.l.; verbatimLatitude: 8°20.268'N; verbatimLongitude: 98°44.707'E; Event: year: 2015; month: 10; day: 12; Record Level: institutionCode: IZCAS-Ar 43530 GoogleMaps GoogleMaps
Description
Male
Unknown.
Female (IZCAS-Ar 43530): PL 3.3, PW 2.4, AW 1.6, OL 3.1, OW 1.6. Eye diameters and interdistances: AME 0.10, ALE 0.13, PME 0.11, PLE 0.11, AME-AME 0.04, AME-ALE 0.11, PME-PME 0.06, PME-PLE 0.24, AME-PME 0.06, ALE-PLE 0.08, clypeus AME 0.12, clypeus ALE 0.17. Palp and leg measurements: palp 3.8 (1.3, 0.7, 0.8, -, 1.0), I 10.3 (2.8, 1.6, 2.8, 2.1, 1.0), II 9.2 (2.4, 1.4, 2.4, 2.0, 1.0), III 9.0 (2.4, 1.3, 2.0, 2.2, 1.1), IV 12.2 (3.1, 1.4, 2.9, 3.5, 1.3). Leg formula 4123. Spination of palp and legs: palp 130, 100, 1111, 1212; femora I p002, d111, r010, II p010, d111, r010, III p111, d111, r012, IV p002, d111, r102; patellae I-IV 001; tibiae I-II v22222, III p11, d111, r11, v222, IV p111, d11, r11, v222; metatarsi I-II v222, III p112, d010, r112, v222, IV p112, r112, v222. Chelicerae with 3 promarginal, 4 + 1 retromarginal teeth, without denticles. Retromargin of chelicerae close to fang base without bristle. Tarsi and metatarsi without scopula. Claw tufts arising separately, but intermingle with each other distally. Palpal claw with 3 secondary teeth, leg claws I-II with 3, III with 2 and IV with 3 secondary teeth. Position of tarsal organ: I 0.76, II 0.72, III 0.68.
Copulatory organ (Fig. 2 View Figure 2 a, b, Fig. 3 View Figure 3 a and b). Epigynal plate width/length: 9.8/6.5; anterior width/posterior width: 9.8/7.5; heart-shaped and with a mating plug, the anterior part with a pair of pointed apophyses ventrally. Lateral teeth pointing postero-medially. Internal duct system with small oval spermathecae not fully visible, separated from each other by more than their diameter; fertilisation ducts elongate and laminar, pointing postero-medially.
Colour (Fig. 2 View Figure 2 c and d). Reddish-brown to yellowish without patterns. Dorsal prosoma slightly reddish-brown to yellowish, with eyes marked with black rings, fovea distinct, reddish-brown. Chelicerae reddish-brown. Sternum, ventral coxae, labium yellowish-brown without patterns. Gnathocoxae yellowish-brown with lighter distal lips. Legs yellowish-brown. Opisthosoma yellowish. Spinnerets yellowish.
Diagnosis
Small Ctenidae (total length female 6.4). The new species can be distinguished from all known congeners by the median plate roughly heart-shaped and with a mating plug (Fig. 2 View Figure 2 a and Fig. 3 View Figure 3 a), by the anterior part of median plate with a pair of pointed apophyses ventrally (arrowed in Fig. 2 View Figure 2 a, arrowed in Fig. 3 View Figure 3 a), by the internal duct system with small oval spermathecae not fully visible (Fig. 2 View Figure 2 b and Fig. 3 View Figure 3 b) and by the fertilisation ducts which are elongate and laminar, almost twice as long as the spermathecae (Fig. 2 View Figure 2 b and Fig. 3 View Figure 3 b).
Etymology
The specific name refers to the type locality and is a noun in apposition.
Distribution
Thailand (Krabi, type locality; Fig. 1 View Figure 1 ).
DNA Barcode
Female (IZCAS-Ar 43530):
TGTTTGGAGCTTGAGCTGCTATAGCAGGAACTGGAATAAGAGTGTTGATTCGAATAGAGTTAGGTCATCCTGGTAGATTGTTAGGAGATGATCATTTATATAATGTTATTGTAACTGCTCATGCTTTTGTAATGATTTTTTTTATAGTAATACCAATTTTGATTGGTGGATTTGGAAATTGATTAGTTCCGTTGAGATTGGAGCACCTGATATATCATTTCCTCGAATAAATAATTTGTCGTTTTGATTACTACCTCCTTCTTTATTTTTATTAATAATATCATCAATAGTAGAAATAGGTGTTGGAGCGGGATGAACTGTTTATCCTCCTTTAGCATCTAGTATTGGGCATATAGGAAGATCTATAGATTTTGCTATTTTTTCTCTTCATTTGGCTGGAGCTTCTTCTATTATAGGAGCAGTAAATTTTATTTCTACTATTATTAATATACGGTTGTATGGAATGAGTATAGAAAAGGTTCCTTTGTTTGTGTGGTCTGTTTTTATTACTGCTATTTTGTTATTATTGTCGTTACCTGTGTTAGCAGGTGCTATTACTATATTATTGACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCGGGAGGGGGAGATCCTATTTTGTTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP561682).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
