Phaenoglyphis evenhuisi Pujade-Villar & Paretas-Martínez, 2006

Vogel, Jonathan, Peters, Ralph S., Selfa, Jesús & Ferrer-Suay, Mar, 2024, Characterising the north-western European species of Phaenoglyphis Förster, 1869 (Hymenoptera: Figitidae: Charipinae) with novel insights from DNA barcode data, Biodiversity Data Journal 12, pp. e 120950-e 120950 : e120950-

Phaenoglyphis evenhuisi Pujade-Villar & Paretas-Martínez, 2006

Materials

Type status: Other material. Occurrence: recordedBy: Vogel, Jonathan; individualCount: 1; sex: female; disposition: in collection; associatedSequences: GBHYG 1732-23; occurrenceID: 4051BAA3-8DFA-513B-81FC-790E2F77BAAD; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: evenhuisi ; scientificNameAuthorship: Pujade-Villar & Paretas-Martínez, 2006; Location: country: Germany; countryCode: DE; stateProvince: Hesse; municipality: Werra-Meißner-Kreis; locality: Großalmerode, Private garden, Siedlerweg ; verbatimElevation: 383 m; decimalLatitude: 51.2591; decimalLongitude: 9.7871; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1632; samplingProtocol: Malaise trap; eventDate: 2022-7 - 12 / 20; year: 2006; habitat: semi-abandoned garden with wet spot, ivy hedge and salix; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2635324; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: GBOL III; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 21D94939-30F2-57B1-9416-9314701C185E; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: evenhuisi ; scientificNameAuthorship: Pujade-Villar & Paretas-Martínez, 2006; Location: country: Germany; countryCode: DE; stateProvince: Hesse; municipality: Waldeck-Frankenberg; locality: National park Kellerwald-Edersee, Kleiner Mehlberg ; verbatimElevation: 370 m; decimalLatitude: 51.2108; decimalLongitude: 9.0428; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1035; samplingProtocol: Malaise trap (Krefeld type); eventDate: 2021-6 / 7 - 22 / 8; year: 2006; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2632880; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; Grabow, K.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 1A2DA62B-1BC5-5BA0-80C6-A3214EC76E49; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: evenhuisi ; scientificNameAuthorship: Pujade-Villar & Paretas-Martínez, 2006; Location: country: Germany; countryCode: DE; stateProvince: Baden-Württemberg; municipality: Karlsruhe; locality: Malsch, Luderbusch ; verbatimElevation: 112 m; decimalLatitude: 48.9144; decimalLongitude: 8.3324; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 864; samplingProtocol: Malaise trap; eventDate: 2020-5 - 10 / 17; year: 2006; habitat: salix-populus forest / wild land; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2634989; basisOfRecord: PreservedSpecimen

Diagnosis

Female antennae with rhinaria beginning on F 4, pedicel shorter than F 1, F 1 longer than F 2, F 2 subequal to F 3, F 3 shorter than F 4 (Fig. 3 b); notauli present, but weak, scutellar foveae present separated by median carina, each fovea has a transverse posterior carina inside (Fig. 4 b); radial cell closed, 3.0 times as long as wide.

Molecular characterisation

Maximum barcode-distance within species: 0.3 % (3).

Minimum barcode-distance to closest species: 8.9 % ( P. longicornis ).

Consensus barcode sequence (652 bp):

5 ’ - TTTATTATATTTTATTTTTGGAATTTGGTCAGGTATAATTGGATCCGCCCTAAGAATAATTATTCGTATAGAATTAGGGACCCCTTCTTCATTAATTGGAAATGATCAAATTTATAATTCAATTGTAACAGCCCACGCTTTTATCATAATTTTTTTTATAGTAATACCTATCATAGTCGGGGGATTTGGTAATTATTTAGTCCCATTAATATTAAGGGCCCCAGATATAGCTTTCCCACGTTTAAATAACATAAGTTTTTGATTATTGCCCCCTGCTTTATTTTTATTAGTTTCTAGAATATTTATTGATCAAGGGGCTGGAACTGGATGAACGGTTTATCCGCCCCTTTCATCTAATTTAGGACATTCAGGAATCTCAGTAGATTTAACTATTTTTTCTTTACATTTAAGAGGTATTTCTTCAATTTTAGGTGCAATTAATTTTATTTCAACAATTTTAAATATACGAATTATTTCCTTAGATAAAATTTCCTTATTTATTTGATCTATTTTTTTAACAACTATTTTATTATTATTATCATTACCTGTATTAGCCGGAGGAATTACAATATTATTATTTGACCGAAATTTAAATACCTCTTTTTTTGACCCTATAGGAGGAGGTGATCCAATTTTATACCAACATTTATTT- 3 ’

Distribution

Andorra and France ( Ferrer-Suay et al. 2023). New record from Germany: Baden-Württemberg, Hesse.

Figures

Figure 3. SEM images of female Phaenoglyphis antennae (all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).

Figure 4. SEM images of Phaenoglyphis mesoscutum (dorsal view; all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).