Aldinomyces Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Aldinomyces Tedersoo gen. nov.

Type species.

Aldinomyces tarquinii Tedersoo .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 139–158 gcggatttcgaaagatttct in type species; one mismatch allowed). Forms a monophyletic, least inclusive clade in Aldinomycetaceae, covering sequences EUK 1205365 , EUK 1124394 , and EUK 0529911 (Figs 1 , 49 ).

Notes.

Recognized based on eDNA sequences only. Comprises about four potential species represented by sequences EUK 0483667 (forest soil in Argentina), EUK 0138900 (forest soil in Norway), and EUK 0529911 ( woodland soil in Estonia).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.

Figure 49. Maximum Likelihood SSU- ITS - LSU phylogram indicating the position of Aldinomyces tarquinii within Aldinomycota, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Members of various fungal phyla were used as an outgroup.