Phaenoglyphis salicis (Cameron, 1883)

Vogel, Jonathan, Peters, Ralph S., Selfa, Jesús & Ferrer-Suay, Mar, 2024, Characterising the north-western European species of Phaenoglyphis Förster, 1869 (Hymenoptera: Figitidae: Charipinae) with novel insights from DNA barcode data, Biodiversity Data Journal 12, pp. e 120950-e 120950 : e120950-

Phaenoglyphis salicis (Cameron, 1883)

Materials

Type status: Other material. Occurrence: recordedBy: Vogel, Jonathan; individualCount: 1; sex: female; disposition: in collection; occurrenceID: CAE83B1F-A869-546B-986C-B850D5B50415; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: salicis ; scientificNameAuthorship: (Cameron, 1883); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Rhein-Sieg-Kreis; locality: Alfter, playground next to " KiTa Rasselbande " ; verbatimElevation: 86 m; decimalLatitude: 50.7343; decimalLongitude: 7.0138; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1514; samplingProtocol: hand picked; eventDate: 2022-5 - 5; year: 1883; habitat: among wood chips on ground; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2634968; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 87B29A24-80BF-5955-AF20-8ED77C8898E3; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: salicis ; scientificNameAuthorship: (Cameron, 1883); Location: country: Germany; countryCode: DE; stateProvince: Rhineland-Palatinate; municipality: Cochem; locality: Nat. res. Brauselay ; verbatimElevation: 94 m; decimalLatitude: 50.1416; decimalLongitude: 7.1875; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 919; samplingProtocol: Malaise trap; eventDate: 2020-5 - 29; year: 1883; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2641264; basisOfRecord: PreservedSpecimen

Diagnosis

Antennae of both sexes with rhinaria beginning on F 3, pedicel shorter than F 1, F 1 longer than F 2, F 2 shorter than F 3, F 3 subequal to F 4 (Fig. 3 d); pronotal carinae present, notauli weak, scutellar foveae oval, completely defined and with two lines anteriorly (Fig. 4 d), propodeal carinae present; radial cell closed, 2.5 times as long as wide.

Molecular characterisation

Maximum barcode-distance within species: 0.2 % (2).

(Minimum) barcode-distance to closest species: 4.9 % ( P. longicornis ).

Consensus barcode sequence (652 bp):

5 ’ - TTTATTGTATTTTATTTTTGGAATTTGATCAGGAATAATTGGATCAGCTTTAAGAATAATTATTCGAATAGAATTAGGCACCCCATCTTCATTAATTGGTAATGACCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAGTAGGAGGATTCGGTAATTATTTAGTTCCTTTAATATTAAGGGCTCCTGATATAGCTTTCCCACGATTAAACAATATAAGTTTTTGATTATTACCCCCCGCTTTATTTTTATTAACTTCTAGAATATTTATTGATCAAGGAGCTGGAACTGGATGAACTGTTTAYCCACCTCTCTCCTCTAATTTAGGCCATTCAGGGATTTCAGTAGATTTAACTATTTTTTCTTTACATTTAAGGGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTTCAACAATTTTAAATATACGAATTATTTCTTTAGATAAAATTTCTTTATTTATCTGATCTATTTTTTTAACAACTATTTTATTATTATTATCATTACCTGTATTAGCAGGAGGGATCACTATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGATCCAATGGGAGGAGGAGACCCTATTTTATACCAACATTTATTT- 3 ’

Distribution

Austria, Germany, Ireland, Italy, Romania, Spain, USA: Colorado, and United Kingdom: England, Scotland, Wales ( Ferrer-Suay et al. 2014, Ferrer-Suay et al. 2023).

Taxon discussion

See the taxon discussion of P. longicornis .

Figures

Figure 3. SEM images of female Phaenoglyphis antennae (all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).

Figure 4. SEM images of Phaenoglyphis mesoscutum (dorsal view; all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).