Nematovomyces soinasteënsis Tedersoo, Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Nematovomyces soinasteënsis Tedersoo sp. nov.

Diagnosis.

Separation from other species of Nematovomyces based on ITS 2 (positions 491–510 aaaaccctttttcccccaca; one mismatch allowed) and LSU (positions 601–620 tgttcttggtactgagttta; one mismatch allowed) as indicated in Fig. 56 . Intraspecific variation up to 2.8 % in ITS 2 and up to 0.3 % in LSU. Interspecific distance at least 8.0 % in ITS 2.

Type.

Vouchered soil sample TUE 000860 ( holotype); eDNA sequence EUK 1124397 = OZ 253814 ( legitype); eDNA sample TUE 100860 ( nucleotype); GSMc plot S 328, Betula pendula dominated forest in Soinaste , Estonia, 58.3322°N, 26.7678°E .

Description.

Other sequences: EUK 1200775 ( GSMc plot S 1183, mixed forest soil in Aldino, Italy, 46.4072°N, 11.4964°E); EUK 1217250 ( GSMc plot G 4679, Salix triandra swamp soil in Prangli Rivimaa, Estonia, 59.6151°N, 24.9871°E); EUK 0330847 ( GSMc plot S 141, Carpinus- Quercus - Alnus forest soil in Shirgah, Iran, 36.2122°N, 52.8243°E); EUK 0483680 ( GSMc plot G 4196, mixed forest soil in Kahvena, Estonia, 58.2799°N, 25.2316°E); EUK 1217249 ( GSMc plot G 4800, Ulmus-Alnus temperate forest soil in Tuhkja, Estonia, 58.4159°N, 25.2327°E); EUK 033840 ( GSMc plot S 939, tropical rainforest soil in Parotania, Bolivia, – 17.5815, – 66.3443°E); and EUK 0330843 ( GSMc plot G 4030, Quercus-Arbutus forest soil in Ain Boumahdi, Morocco, 34.0096, – 4.2858, 24.9871°E).

Etymology.

Soinaste (Estonian) refers to the type locality.

Notes.

Found in forest soils in Eurasia, North Africa, Central Asia, and South America (n = 18 records). The 16 additional GlobalFungi records indicate occurrence in soil and root samples across various ecosystems and biomes in Spain, China, and the USA.

Figures

Figure 56. Diagnostic nucleotide sequences of Nematovomyces soinasteënsis relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).