Terrincolales Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Terrincolales Tedersoo & Esmaeilzadeh-Salestani ord. nov.

Type family.

Terrincolaceae Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signature in 5.8S (positions 6–26 in type species and S. cerevisiae ttcaacaatggatccctcg; no mismatch allowed), LSU D 1 (positions 4–23 in type species and S. cerevisiae tcctcaaatcaagcaagagt; no mismatch allowed), LSU D 2 (positions 255–264 in type species and 244–253 in S. cerevisiae ttggtagtgg; one mismatch allowed), and SSU V 3 (positions 647–651 ggcttg in S. cerevisiae ; no mismatch allowed). Forms a monophyletic, least inclusive clade in Calcarisporiellomycetes, covering sequences MW 791967, EUK 1138132 , EUK 1123677 , EUK 0332618 , EUK 1123675 , EUK 1604147 , EUK 1604155 , and EUK 1123676 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Encoded as clade GS 94 in EUKARYOME v 1.9. Currently includes Terrincolaceae (fam. nov.) and a potentially family-level group represented by sequences EUK 1604147 (tundra soil in AK, USA) and EUK 1604155 (forest soil in LO, USA). Terrincolales comprises potentially 50–70 species. Detected exclusively in soil (100 % out of the 249 records) in tundra to hot tropical biomes across all continents, excluding Antarctica.

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.