Tropicochytrium toronegroense Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Tropicochytrium toronegroense Tedersoo sp. nov.

Diagnosis.

Separation from other species of Tropicochytrium based on ITS 2 (positions 182–201 gggggcctcgtctccccttt; one mismatch allowed) and LSU D 2 (positions 536–555 gaccccgccctcacgggtgg; no mismatch allowed) as indicated in Fig. 13 . Intraspecific variation up to 2.1 % in ITS 2. Interspecific distance at least 3.1 % in ITS 2.

Type.

Vouchered soil sample TUE 002012 ( holotype); eDNA sequence EUK 1186756 = OZ 253791 ( legitype); eDNA sample TUE 102012 ( nucleotype); GSMc plot G 5035; tropical rainforest soil in Toro Negro , Puerto Rico, 18.1770, –66.4884 .

Description.

Other sequences: EUK 0649723 ( GSMc plot MX 35, Pinus chiapensis - dominated tropical forest, Mecacalvo, Veracruz, Mexico, 19.7760, –97.1016); EUK 0649724 ( GSMc plot S 914, tropical forest in Lagos de Monte Bello, Chiapas, Mexico, 16.1004, –91.6871); EUK 0649725 ( GSMc plot G 5037, tropical forest in Maricao, Puerto Rico, 18.1450, –66.9669); EUK 0137040 , EUK 0474865 and EUK 0519433 (all GSMc plot S 381, tropical forest soil in Col Palmarena, Costa Rica, 10.2211, –84.5992); and EUK 0474859 and EUK 0519530 (both GSMc plot JYK 042, tropical forest soil in Barclayville, Liberia, 4.6777°N, 8.1230°E).

Etymology.

Tropica (Greek) refers to the tropics, where the genus mainly occurs; Toro Negro (Spanish) refers to the type locality.

Notes.

Found in soil in tropical rainforest habitats of Central America and West Africa (six localities). There are no additional GlobalFungi records.

Figures

Figure 13. Diagnostic nucleotide sequences of Tropicochytrium toronegroense relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).