Gelotisporidium boreale Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Gelotisporidium boreale Tedersoo sp. nov.

Diagnosis.

Separation from other species of Gelotisporidiaceae based on ITS 2 (positions 111–130 ggcaagcccaaccgggagta; one mismatch allowed) and LSU (positions 481–500 gagttgtgtcacatatagca; one mismatch allowed) as indicated in Fig. 44 . Intraspecific variation up to 4.7 % in ITS 2 and up to 1.0 % in LSU. Interspecific distance> 15 % in ITS 2 and> 10 % in LSU.

Type.

Vouchered soil sample TUE 000189 ( holotype); eDNA sequence EUK 1201985 = OZ 253809 ( legitype); eDNA sample TUE 100189 ( nucleotype); GSMc plot G 2836, Betula spp. dominated tundra soil in Gelotjávri , Finland, 68.6035°N, 21.7452°E .

Description.

Other sequences: EUK 1101158 (coniferous forest soil in Hofors, Sweden, 60.49°N, 16.3°E); EUK 0325837 ( GSMc plot S 1124, mixed forest soil in Zavodoukovskiy, Tyumen Oblast, Russian Federation, 56.5299°N, 66.5028°E); EUK 0473501 ( GSMc plot IHPR 02, Betula pubescens tundra soil in Stora Sjöfallet, Sweden, 67.6367°N, 17.8216°E); EUK 0325836 ( Betula pubescens tundra soil at Lake Sobach’ye, Krasnoyarsk Krai, Russian Federation, 69.0033°N, 90.9875°E); and EUK 0325821 ( GSMc plot S 1081, Araucaria araucana forest soil in Nahuelbuta, Chile, – 37.7897, – 73.0034°E).

Etymology.

Gelot (Sámi) refers to the type locality at Gelotjávri (Kelottijärvi), and boreale (Latin) refers to the mainly boreal habitat of the species.

Notes.

Found in 40 soil samples in boreal and subarctic habitats in Fennoscandia, the Northern Russian Federation, and Alaska, and once in the Chilean highlands (has unique substitutions). The 27 additional GlobalFungi records indicate habitat in soil and dead wood (11.1 %) and distribution in the Holarctic realm.

Figures

Figure 44. Diagnostic nucleotide sequences of Gelotisporidium boreale relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).