Tropicochytrium Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Tropicochytrium Tedersoo gen. nov.

Type species.

Tropicochytrium toronegroense Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signature in ITS 2 (positions 108–127 in type species ctcgtggtccgcaaggcttt; one mismatch allowed) and LSU D 2 (positions 557–577 in type species and 549–569 in S. cerevisiae agtttatagcctccggtcctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tropicochytriaceae, covering sequences EUK 1186758 , EUK 0519487 , and EUK 1186756 (Figs 1 , 12 ).

Notes.

Recognized based on eDNA sequences only. Comprises potentially 20–25 species represented by sequences EUK 0519487 (forest soil in the Philippines), EUK 1186758 (forest soil in Guadeloupe), EUK 1186753 (forest soil in Puerto Rico), and EUK 0131338 (grassland soil in Colombia).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.

Figure 12. Maximum Likelihood SSU- ITS - LSU phylogram indicating the position of Tropicochytrium toronegroense within Tropicochytriomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Chytridiomycota spp. were used as an outgroup.