Bowie engkilili S. Li & Yao, 2022

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

Bowie engkilili S. Li & Yao sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: Z. Bai; individualCount: 1; sex: female; lifeStage: adult; Taxon : order: Araneae ; family: Ctenidae ; genus: Bowie ; Location: country: Malaysia; locality: Engkilili ; verbatimElevation: 5 m a.s.l.; verbatimLatitude: 1°6.367'N; verbatimLongitude: 111°43.933'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2018; month: 9; day: 10; Record Level: institutionCode: IZCAS-Ar 43731

Description

Male

Unknown.

Female (IZCAS-Ar 43731): PL 4.5, PW 3.6, AW 2.3, OL 3.9, OW 2.3. Eye diameters and interdistances: AME 0.21, ALE 0.11, PME 0.26, PLE 0.23, AME-AME 0.15, AME-ALE 0.31, PME-PME 0.27, PME-PLE 0.35, AME-PME 0.13, ALE-PLE 0.17, clypeus AME 0.14, clypeus ALE 0.41. Palp and leg measurements: palp 4.7 (1.6, 0.9, 1.1, -, 1.1), I missing, II 10.8 (3.0, 1.7, 2.7, 2.5, 0.9), III 10.2 (2.7, 1.7, 2.2, 2.5, 1.1), IV 14.4 (3.7, 1.6, 3.4, 4.2, 1.5). Leg formula 4123. Spination of palp and legs: palp 131, 001, 112, 2012; femora II p110, d111, r112, III p012, d111, r112, IV p002, d111, r112; patellae II 000, III-IV 101; tibiae II v22222, III-IV p11, d111, r11, v222; metatarsi II v222, III p112, d010, r112, v222, IV p112, d010, r112, v2222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 5 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 5 bristles. Sparse scopula restricted almost entirely to tarsi. Palpal claw with 7 secondary teeth, leg claws II-IV with 3 secondary teeth. Position of tarsal organ: II 0.75, IV 0.85.

Copulatory organ (Fig. 24 a, b and Fig. 25 ). Epigynal field slightly longer than wide, with narrow separated anterior bands laterally. Median plate with a median bulge in anterior half, laterally with two separate sclerotised patches, constricted at lateral teeth, the latter moderately pointed. Spermathecae small, separated by more than twice their diameter, roundish, smaller chamber bend at right angle, laterad.

Colour (Fig. 24 c and d). Reddish-brown to yellowish with dark patterns. Dorsal prosoma with characteristic lighter median band, widened behind eyes, distinctly marked fovea and indistinct radial markings. Sternum and ventral coxae yellowish, labium and gnathocoxae reddish-brown. Chelicerae black. Leg reddish-brown. Dorsal and lateral opisthosoma black. Ventral opisthosoma black with light patterns. Spinnerets and anal tubercle black.

Diagnosis

Small Ctenidae (total length female 8.4). The new species resembles B. withinyou Jäger, 2022 (see Jäger 2022: figs 629-630 and 634-636) by having similar fertilisation ducts (Fig. 24 b), but can be distinguished by the lateral teeth pointing medially (Fig. 24 a; lateral teeth pointing postero-medially in B. withinyou ), by the median plate with two separate sclerotised patches laterally and a longer median bulge in anterior half (Fig. 24 a and Fig. 25 ; median plate with shorter median bulge in anterior half in B. withinyou ) and by the spermathecae separated by more than twice their diameter (Fig. 24 b; spermathecae separated by 1.5 times their diameter in B. withinyou ).

Etymology

The specific name refers to the type locality and is a noun in apposition.

Distribution

Malaysia (Engkilili, type locality; Fig. 1 ).

DNA Barcode

Female (IZCAS-Ar 43731):

TATTTGGGGCTTGAGCTTCTATAGCTGGTACATCTATAAGTGTTTTGATTCGTATGGAGTTGGGACATTCGGGGAGAATATTGGGAGATGATCATCTCTATAATGTTATTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTTTAATTGGAGGTTTTGGTAATTGGTTGGTTCCTTTAATGTTAGGGGCTCCTGATATGTCGTTTCCTCGAATAAATAATTTGTCTTTTTGGTTACTTCCTCCTTCTTTATTTTTATTGTTTATGTCTTCTATAACTGAAATAGGGGTAGGAGCTGGTTGAACGGTGTATCCTCCTTTGGCTTCAAGAATGGGTCATGCTGGTAGATCTATGGATTTTGCTATTTTTTCTCTTCATTTAGCTGGGGCGTCTTCTATTATAGGTGCTATTAATTTTATTTCTACTATTATTAATATGCGTTTATTAGGAATGAGAATAGAGAAAGTTCCTTTGTTTGTATGGTCTGTTTTTATTACTGCGGTATTGTTATTATTGTCTCTTCCTGTTTTGGCAGGAGCTATTACTATATTGTTAACTGATCGTAATTTTAATACTTCTTTTTTTGATCCGGCTGGAGGGGGAGATCCGATTTTATTTCAACATTTATTTTGATTTTTT (GenBank accession number OP572106).

Figures

Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n.

Figure 24. Bowie engkilili sp. n., holotype female. a: Epigyne, ventral view; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. AB = anterior bulge of median plate, FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c, d).

Figure 25. Bowie engkilili sp. n., epigyne, posterior view. AB = anterior bulge of median plate, LT = lateral teeth. Scale bar: 0.1 mm.