Phaenoglyphis villosa (Hartig, 1841)

Vogel, Jonathan, Peters, Ralph S., Selfa, Jesús & Ferrer-Suay, Mar, 2024, Characterising the north-western European species of Phaenoglyphis Förster, 1869 (Hymenoptera: Figitidae: Charipinae) with novel insights from DNA barcode data, Biodiversity Data Journal 12, pp. e 120950-e 120950 : e120950-

Phaenoglyphis villosa (Hartig, 1841)

Materials

Type status: Other material. Occurrence: recordedBy: Salden, Tobias; individualCount: 1; sex: male; disposition: in collection; associatedSequences: GBHYG 1718-23; occurrenceID: 15BA6329-6566-54F2-AE00-DB2A35B95466; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Bonn; locality: ZFMK ; verbatimElevation: 67 m; decimalLatitude: 50.7214; decimalLongitude: 7.1139; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1766; samplingProtocol: sweep net; eventDate: 2022-10 - 4; year: 1841; habitat: garden; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2635310; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Salden, Tobias; individualCount: 1; sex: male; disposition: in collection; associatedSequences: GBHYG 1719-23; occurrenceID: 53FE4D5B-EE46-5EA1-B0EA-E1E86F899E5E; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Bonn; locality: ZFMK ; verbatimElevation: 67 m; decimalLatitude: 50.7214; decimalLongitude: 7.1139; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1766; samplingProtocol: sweep net; eventDate: 2022-10 - 4; year: 1841; habitat: garden; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2635311; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: ZFMK et al.; individualCount: 1; sex: female; disposition: in collection; associatedSequences: GBHYG 1782-23; occurrenceID: 46C44CF6-D965-5B64-B9BF-AFC1FEF77459; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Rhein-Sieg-Kreis; locality: Schladern near Windeck, Sieg river, right river bank ; verbatimElevation: 131 m; decimalLatitude: 50.8000; decimalLongitude: 7.5850; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 35; samplingProtocol: Malaise trap; eventDate: 2017-6 - 13 / 20; year: 1841; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2628162; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Remschak; individualCount: 1; sex: female; disposition: in collection; associatedSequences: GBHYG 1874-23; occurrenceID: BB7FED16-1BF5-5B5F-BF31-DF061C1BABD2; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Austria; countryCode: AT; municipality: NP Gesäuse; locality: Gsengquelle ; verbatimElevation: 683 m; decimalLatitude: 47.5683; decimalLongitude: 14.5902; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1424; samplingProtocol: sweep net; eventDate: 2015-7 - 10; year: 1841; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2635167; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Schwingeler, Josefine; Vogel, Jonathan; individualCount: 1; sex: male; disposition: in collection; associatedSequences: LIBNP 001-23; occurrenceID: AC483528-0A8B-57B0-B450-B4CBB823B8E7; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Bonn; locality: Garden of Museum Koenig ; verbatimElevation: 67 m; decimalLatitude: 50.7215; decimalLongitude: 7.1137; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1392; samplingProtocol: sweep net; eventDate: 2022-7 - 4; year: 1841; habitat: Various habitats; Record Level: language: en; institutionID: ZFMK; collectionID: HM 128-04 - CC; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Vogel, Jonathan; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 2C6471CC-548E-5C9C-8BDF-32267C8050C2; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Sweden; countryCode: SE; stateProvince: Uppland; municipality: Stockholm; locality: Stora skuggan ; verbatimElevation: 21 m; decimalLatitude: 59.3650; decimalLongitude: 18.0800; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 910; samplingProtocol: sweep net; eventDate: 2021-8 - 31; year: 1841; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2632498; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: ZFMK et al.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 171B7091-428B-5444-8072-4FCF9770275F; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Rhein-Sieg-Kreis; locality: Schladern near Windeck, Sieg river, right river bank ; verbatimElevation: 131 m; decimalLatitude: 50.8000; decimalLongitude: 7.5850; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 37; samplingProtocol: Malaise trap; eventDate: 2017-5 - 23 / 30; year: 1841; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2632692; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Van Steenis, Jeroen; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 57243196-E6EE-552E-B41D-0F2C8C106AF0; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Iceland; countryCode: IS; stateProvince: 1; municipality: Gardðabær; locality: Vífilsstaðavatn ; verbatimElevation: 40 m; decimalLatitude: 64.0700; decimalLongitude: - 21.8800; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1230; samplingProtocol: Malaise trap; eventDate: 2021-7 - 13 / 29; year: 1841; habitat: lake shore; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2634650; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Vogel, Jonathan; individualCount: 1; sex: male; disposition: in collection; occurrenceID: C02697B2-F437-5666-83DE-2FBC8C1ED7E2; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Saxony; municipality: Leipzig; locality: Lake Störmthal (southern bank) ; verbatimElevation: 117 m; decimalLatitude: 51.2278; decimalLongitude: 12.4566; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1007; samplingProtocol: sweep net; eventDate: 2021-7 - 13; year: 1841; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2634971; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 50EF98FF-58C2-5C81-9B41-C09575ECE50E; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Saxony-Anhalt; municipality: Saalekreis; locality: Nat. res. " Porphyrlandschaft bei Gimritz " ; verbatimElevation: 114 m; decimalLatitude: 51.5593; decimalLongitude: 11.8446; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1073; samplingProtocol: Malaise trap; eventDate: 2020-6 - 2; year: 1841; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2635208; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; Voith, J.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 679C05FC-6D7A-5EE8-83FA-5F2D01F0C4D1; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Bavaria; municipality: Garmisch-Partenkirchen; locality: Zugspitze ; verbatimElevation: 1965 m; decimalLatitude: 47.4062; decimalLongitude: 11.0095; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 2334; samplingProtocol: Malaise trap; eventDate: 2018-7 / 8 - 18 / 2; year: 1841; habitat: mountain; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2637886; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; Voith, J.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 7E3396F2-CC52-5B99-B010-96CA618D498F; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Bavaria; municipality: Garmisch-Partenkirchen; locality: Zugspitze ; verbatimElevation: 2005 m; decimalLatitude: 47.4068; decimalLongitude: 11.0080; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 2339; samplingProtocol: Malaise trap; eventDate: 2018-8 / 9 - 13 / 11; year: 1841; habitat: mountain; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2637887; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; Voith, J.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 662BA65B-2C72-508D-AF8F-E92457B30BF6; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Bavaria; municipality: Garmisch-Partenkirchen; locality: Zugspitze ; verbatimElevation: 1965 m; decimalLatitude: 47.4062; decimalLongitude: 11.0095; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 2334; samplingProtocol: Malaise trap; eventDate: 2018-7 / 8 - 18 / 2; year: 1841; habitat: mountain; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2637889; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; Voith, J.; individualCount: 1; sex: male; disposition: in collection; occurrenceID: E66C422C-AD47-5816-BB3B-AD313CCA5602; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Bavaria; municipality: Garmisch-Partenkirchen; locality: Zugspitze ; verbatimElevation: 1965 m; decimalLatitude: 47.4062; decimalLongitude: 11.0095; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 2341; samplingProtocol: Malaise trap; eventDate: 2018-9 / 10 - 11 / 9; year: 1841; habitat: mountain; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2638011; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; Voith, J.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 754FA597-6BF1-55D2-9769-5AB764824C95; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Bavaria; municipality: Garmisch-Partenkirchen; locality: Zugspitze ; verbatimElevation: 2005 m; decimalLatitude: 47.4068; decimalLongitude: 11.0080; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 2339; samplingProtocol: Malaise trap; eventDate: 2018-8 / 9 - 13 / 11; year: 1841; habitat: mountain; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2638012; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; Voith, J.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: D0A827CC-2964-5C57-B2F2-3D941E35329D; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Bavaria; municipality: Schwandorf; locality: Bodenwöhr, Postlohe ; verbatimElevation: 360 m; decimalLatitude: 49.2760; decimalLongitude: 12.3507; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 881; samplingProtocol: Malaise trap; eventDate: 2016-6 - 6 / 25; year: 1841; habitat: forest hamletmarshland forest; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2640634; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Schwingeler, Josefine; Vogel, Jonathan; individualCount: 1; sex: male; disposition: in collection; occurrenceID: 67E5DC82-3C54-5909-88BD-98CB237AF51C; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Bonn; locality: Garden of Museum Koenig ; verbatimElevation: 67 m; decimalLatitude: 50.7215; decimalLongitude: 7.1137; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1392; samplingProtocol: sweep net; eventDate: 2022-7 - 4; year: 1840; habitat: Various habitats; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2640976; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Schwingeler, Josefine; Vogel, Jonathan; individualCount: 1; sex: male; disposition: in collection; occurrenceID: 29634819-6E30-5986-BB5B-3B002865BE05; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Bonn; locality: Garden of Museum Koenig ; verbatimElevation: 67 m; decimalLatitude: 50.7215; decimalLongitude: 7.1137; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1392; samplingProtocol: sweep net; eventDate: 2022-7 - 4; year: 1841; habitat: Various habitats; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2640977; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Schwingeler, Josefine; Vogel, Jonathan; individualCount: 1; sex: male; disposition: in collection; occurrenceID: 928C059C-F999-5646-AE03-2DD5FBF81B51; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Bonn; locality: Garden of Museum Koenig ; verbatimElevation: 67 m; decimalLatitude: 50.7215; decimalLongitude: 7.1137; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1392; samplingProtocol: sweep net; eventDate: 2022-7 - 4; year: 1841; habitat: Various habitats; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2640978; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Schwingeler, Josefine; Vogel, Jonathan; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 803A7FF9-63BB-56A6-839B-236D6F9E14E5; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Bonn; locality: Garden of Museum Koenig ; verbatimElevation: 67 m; decimalLatitude: 50.7215; decimalLongitude: 7.1137; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1392; samplingProtocol: sweep net; eventDate: 2022-7 - 4; year: 1841; habitat: Various habitats; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2640979; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Krogmann, Lars; individualCount: 1; sex: female; disposition: in collection; occurrenceID: AAE1D554-C1E5-55D0-853D-9DC9580E63D6; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Lower Saxony; municipality: Lüchow-Dannenberg; locality: Pevestorf, Deichvorland & Deich ; verbatimElevation: 22 m; decimalLatitude: 53.0636; decimalLongitude: 11.4742; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 159; samplingProtocol: Malaise trap; eventDate: 2013-8 - 6 / 10; year: 1841; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641188; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Gilgenbach, Carolin; individualCount: 1; sex: male; disposition: in collection; occurrenceID: 5C1E7871-320D-59A0-A5F2-B90F4680DA4B; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Rhineland-Palatinate; municipality: Alzey-Worms; locality: Wine fields north of Monsheim ; verbatimElevation: 145 m; decimalLatitude: 49.6406; decimalLongitude: 8.2137; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1101; samplingProtocol: Malaise trap; eventDate: 2021-8 - 5 / 24; year: 1841; habitat: shrub islands between wine fields, mostly poplars; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641198; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, Dieter; Grabow, K.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: EF5B377A-B79B-5D1D-8995-6323F8F6CFC2; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Baden-Württemberg; municipality: Karlsruhe; locality: Malsch, Luderbusch ; verbatimElevation: 114 m; decimalLatitude: 48.9156; decimalLongitude: 8.3320; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1397; samplingProtocol: Malaise trap; eventDate: 2020-4 / 5 - 26 / 3; year: 1841; habitat: pond, gravel bank, salix bush; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641209; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 7CFBA8D2-C7AD-5902-8BCB-85C216AE519E; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Baden-Württemberg; municipality: Karlsruhe; locality: Malsch, Hansjakobstraße ; verbatimElevation: 120 m; decimalLatitude: 48.8835; decimalLongitude: 8.3197; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 804; samplingProtocol: Malaise trap; eventDate: 2020-4 / 5 - 26 / 10; year: 1841; habitat: garden; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641217; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: E0A0AB79-2843-5B6F-BAF0-02E2FAD4CEE3; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Baden-Württemberg; municipality: Karlsruhe; locality: Malsch, Hansjakobstraße ; verbatimElevation: 120 m; decimalLatitude: 48.8835; decimalLongitude: 8.3197; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 804; samplingProtocol: Malaise trap; eventDate: 2020-4 / 5 - 26 / 10; year: 1841; habitat: garden; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641218; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, D.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 5B3BEAA4-EEB9-50BE-AA1B-A9DB3298784F; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Baden-Württemberg; municipality: Karlsruhe; locality: Malsch, Hansjakobstraße ; verbatimElevation: 120 m; decimalLatitude: 48.8835; decimalLongitude: 8.3197; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 804; samplingProtocol: Malaise trap; eventDate: 2020-4 / 5 - 26 / 10; year: 1841; habitat: garden; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641220; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: male; disposition: in collection; occurrenceID: 150B367C-64E1-5377-A0DE-082E66D0AC7B; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Mecklenburg-Vorpommern; municipality: Greifswald; locality: Nat. res. Insel Koos ; verbatimElevation: - 1 m; decimalLatitude: 54.1694; decimalLongitude: 13.3690; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 933; samplingProtocol: Malaise trap; eventDate: 2020-5 - 30; year: 1841; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2641221; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 31794BBB-2E5B-5AB1-B6FE-574F37A281B3; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Mecklenburg-Vorpommern; municipality: Greifswald; locality: Nat. res. Insel Koos ; verbatimElevation: - 1 m; decimalLatitude: 54.1694; decimalLongitude: 13.3690; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 933; samplingProtocol: Malaise trap; eventDate: 2020-5 - 30; year: 1841; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2641222; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 75A4827D-F6C0-5879-A86D-9C0BA0016B6A; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Mecklenburg-Vorpommern; municipality: Greifswald; locality: Nat. res. Insel Koos ; verbatimElevation: - 1 m; decimalLatitude: 54.1694; decimalLongitude: 13.3690; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 933; samplingProtocol: Malaise trap; eventDate: 2020-5 - 30; year: 1841; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2641223; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Vogel, Jonathan; individualCount: 1; sex: male; disposition: in collection; occurrenceID: 7211E815-0770-514E-8E97-3AC6C6FCABD3; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Bonn; locality: ZFMK garden ; verbatimElevation: 68 m; decimalLatitude: 50.7218; decimalLongitude: 7.1132; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1782; samplingProtocol: sweep net; eventDate: 2020-9 - 15; year: 1841; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641237; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Vogel, Jonathan; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 4D747275-939D-5149-ADFB-91F88B00E75C; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: North Rhine-Westphalia; municipality: Rhein-Sieg-Kreis; locality: Alfter, Möthengasse ; verbatimElevation: 87 m; decimalLatitude: 50.7365; decimalLongitude: 7.0120; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 778; samplingProtocol: sweep net; eventDate: 2021-5 - 21; year: 1841; habitat: private lawn; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641263; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 2F7C913F-FFA7-5D2D-AC55-4544D0923048; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Thuringia; municipality: Schmalkalden, Meiningen; locality: Nat. res. Hofberg ; verbatimElevation: 408 m; decimalLatitude: 50.6959; decimalLongitude: 10.2313; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 925; samplingProtocol: Malaise trap; eventDate: 2020-5 - 30; year: 1841; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2641271; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: female; disposition: in collection; occurrenceID: DDEEF32F-F3DA-5BF5-A830-059D1BC825BB; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Mecklenburg-Vorpommern; municipality: Greifswald; locality: Nat. res. Insel Koos ; verbatimElevation: - 1 m; decimalLatitude: 54.169; decimalLongitude: 13.3691; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 931; samplingProtocol: Malaise trap; eventDate: 2020-5 - 30; year: 1841; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2641273; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 0AA25F4B-567A-50A0-87B3-EB394EB0FE34; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Mecklenburg-Vorpommern; municipality: Greifswald; locality: Nat. res. Insel Koos ; verbatimElevation: - 1 m; decimalLatitude: 54.169; decimalLongitude: 13.3691; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 931; samplingProtocol: Malaise trap; eventDate: 2020-5 - 30; year: 1841; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2641274; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: DINA; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 3FB8E391-DBEC-55A1-B84A-80941245288B; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Thuringia; municipality: Erfurt; locality: Nat. res. Schwellenburg ; verbatimElevation: 203 m; decimalLatitude: 51.03; decimalLongitude: 10.9549; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 940; samplingProtocol: Malaise trap; eventDate: 2020-5 - 30; year: 1841; Record Level: language: en; institutionID: EVK; collectionID: ZFMK-TIS- 2641279; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Taxon Expeditions Team; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 9B3553F6-6B91-574E-AC16-5E91706C9B05; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: The Netherlands; countryCode: NL; stateProvince: Noord-Holland; municipality: Amsterdam; locality: Vondelpark ; verbatimElevation: 2 m; decimalLatitude: 52.3581; decimalLongitude: 4.8681; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1428; samplingProtocol: Malaise trap; eventDate: 2019-6 - 21 / 25; year: 1841; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641296; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Doczkal, Dieter; Voith, J.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 955A1D42-85A3-5818-8E30-52304C877207; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: villosa ; scientificNameAuthorship: (Hartig, 1841); Location: country: Germany; countryCode: DE; stateProvince: Bavaria; municipality: Garmisch-Partenkirchen; locality: Zugspitze, Platt ; verbatimElevation: 1980 m; decimalLatitude: 47.4053; decimalLongitude: 11.0091; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1425; samplingProtocol: Malaise trap; eventDate: 2018-7 - 5 / 18; year: 1841; habitat: mountain; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641297; basisOfRecord: PreservedSpecimen

Diagnosis

Antennae of both sexes with rhinaria beginning on F 3, pedicel as long as F 1, F 1 subequal to F 2, F 2 shorter than F 3, F 3 shorter than F 4 (Fig. 3 f); pronotal carinae present, notauli absent, scutellum with two deep foveae, oval, more or less separated by median carina or completely fused (Fig. 4 f), propodeal carinae present; radial cell partially open, 2.1-2.7 times as long as wide.

Molecular characterisation

Maximum barcode-distance within species: 2.6 % (37).

Minimum barcode-distance to closest species: 6.3 % ( P. belizini ).

Consensus barcode sequence (652 bp):

5 ’ - AATTTTATATTTTATTTTTGGAATTTGGTCAGGAATAATTGGCTCTGCATTAAGAATAATTATTCGTATAGAATTAGGGACTCCTTCACAATTTATTGGGAATGATCAAATTTATAATTCAATTGTGACAGCTCATGCTTTTATTATAATTTTTTTTATAGTGATACCTATTATAGTTGGAGGATTTGGTAATTATTTAGTCCCTTTAATATTATCAGCACCAGATATAGCGTTCCCTCGTCTTAATAATATAAGATACTGATTATTATTACCAGCATTAATTTTATTAGTTTCAAGAATATTTATTGATCAAGGGGCAGGAACAGGATGAACAGTTTATCCACCTTTATCTTCTAATTTAAGACATTCAGGAATTTCAGTTGATTTAACAATTTTTGCTTTACATTTAAGGGGGGTTTCTTCAATTTTAGGGTCAATTAATTTTATTACTACAATTTTAAATATACGAATTATTTCAATAGATAAAATTTCTTTATTTATTTGGTCTATTTTCCTAACAACAATTTTATTATTATTATCTTTACCGGTTCTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATATAAATACTTCTTTTTTTGACCCTATAGGAGGAGGGGATCCAATTTTATACCAACATTTATTT - 3 ’

Distribution

Cosmopolitan ( Ferrer-Suay et al. 2023).

Taxon discussion

P. villosa is reported to be morphologically considerably variable ( Pujade-Villar et al. 2007). Here, the second-ranked partition of the ASAP species delimitation algorithm infers four separate entities within P. villosa . All other algorithms infer the clusters as conspecific. As we can neither find consistent morphological traits to separate the putative species nor find any geographic or temporal (collecting months) patterns within and between the molecular clusters, we treat all included specimens as belonging to P. villosa . The high intraspecific variability in both morphology and molecular data might, however, indicate a cryptic species complex behind P. villosa that requires more in-depth studies.

Figures

Figure 3. SEM images of female Phaenoglyphis antennae (all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).

Figure 4. SEM images of Phaenoglyphis mesoscutum (dorsal view; all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).