Venanus johnnyrosalesi Fernandez-Triana & Whitfield
|
publication ID |
https://dx.doi.org/10.3897/BDJ.2.e4167 |
|
persistent identifier |
https://treatment.plazi.org/id/A4DF26CF-A6CC-7DFB-4BB5-76F4566C949B |
|
treatment provided by |
|
|
scientific name |
Venanus johnnyrosalesi Fernandez-Triana & Whitfield |
| status |
sp. n. |
Venanus johnnyrosalesi Fernandez-Triana & Whitfield ZBK sp. n.
Materials
Type status: Holotype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031445 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031445; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38355; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 11/17/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031434 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031434; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38344; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 10/27/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031452 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031452; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38362; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/01/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031455 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031455; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38365; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/15/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031456 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031456; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38366; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/15/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031461 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031461; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38371; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/22/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031462 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031462; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38372; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/22/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031466 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031466; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38376; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/29/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031470 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031470; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38380; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/05/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031472 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031472; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38382; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/12/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031473 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031473; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38383; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/12/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031480 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031480; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38390; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/26/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031481 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031481; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38391; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 02/02/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031486 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031486; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38396; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/16/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031487 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031487; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38397; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/16/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031489 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031489; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38399; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/23/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031491 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031491; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38401; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/23/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031493 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031493; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38403; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/30/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031494 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031494; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38404; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/30/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031497 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031497; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38407; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/02/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031498 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031498; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38408; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/02/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031499 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031499; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38409; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 04/06/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps
Description
Female. Body length: 2.3 mm. Fore wing length: 2.2 mm. Flagellomere 2 length/width: 0.11 mm/0.05 mm. Flagellomere 14 length/width: 0.08 mm/0.06 mm. Oculo-ocellar distance: 0.14 mm. Distance between posterior ocelli: 0.08 mm. Diameter of posterior ocellus: 0.05 mm. Metafemur length/width: 0.52 mm/0.20 mm. Metatibia length: 0.62 mm. Mediotergite 1 length/maximum width/minimum width: 0.30/0.15/0.08 mm. Mediotergite 2 length/width at posterior margin: 0.13/0.08 mm. Figs 1, 2.
Male: As female, but metafemur thinner and antenna longer.
Diagnosis
The mediotergite 1 is relatively long and with a slight constriction near anterior end (Fig. 2). That character is also shared with other three species of Venanus . However, V. johnnyrosalesi can be separated from V. helavai by its much smaller size (2.3 mm vs 2.8-3.0 mm) and less sculptured propodeum, from V. yanayacuensis by its wider discal cell in fore wing (1.0 × vs 1.2 × as wide as high), metasoma color (brown vs black) and fore wing vein 2RS significanly longer than vein r (shorter than r in yanayacuensis ), and from V. randallgarciai by proportion of veins 2RS and r (1.4 × vs 2.0 ×), sculpture of metapleuron and mediotergite 2, and less narrow mediotergite 1 (narrowest width 0.8 × width at posterior margin vs 0.6 × in randallgarciai ).
Etymology
Venanus johnnyrosalesi is named in honor of Sr. Johnny Rosales , currently of San Jose, Costa Rica, but also a major user, appreciator and former director of ACG.
Distribution
Only know from Volcán Cacao, ACG, Costa Rica.
Notes
A total of 60 specimens (some of them not examined for this paper) were sampled for DNA, and 50 rendered full barcode sequences of 658 base pairs (see also Suppl. material 1). These sequences were characterised by very limited variation (a single synonymous, third base G/A transition). The holotype specimen (DHJPAR0031445) has the sequence accession ASHYG706-10 in BOLD (www.boldsystems.org) and the nucleotide sequence is reproduced below:
AATATTATACTTTATTTTTGGGTTATGAGCTGGTATAGTAGGATTTTCTATAAGAATAATCATTCGCTTAGAATTAGGAATACCTGGAAATTTAATTGGAAATGACCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATCATAATTGGTGGATTTGGTAACTGATTAATTCCTTTAATATTAGGTACTCCAGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGGTTACTTCTACCTTCATTATTTTTATTAATTTTAAGTAGATTTATTAATACAGGGGTAGGAACGGGATGAACAGTATACCCTCCTTTGTCATTAATTTTAGGCCATGGGGGAATATCAGTAGACCTGGGTATTTTTTCTCTTCATTTAGCAGGAATATCTTCAATTATAGGGGCTATTAATTTTATTTCCACAATTATAAATATACGAACAAATTTTTTAATAATAGACAAAATCTCTTTATTTTCATGATCTGTTTTAATTACAGCTATTTTATTACTTCTATCTTTACCAGTTTTAGCTGGAGCAATTACTATACTACTGACAGATCGAAATTTAAATACAAGATTTTTTGATCCAAGTGGAGGTGGAGATCCAATTCTTTATCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
