Thinophilus reizlae, Ramos & Ang & Grootaert, 2020

Ramos, Kay, Ang, Yuchen & Grootaert, Patrick, 2020, ‘ Fake widespread species’: a new mangrove Thinophilus Wahlberg (Diptera, Dolichopodidae) from Bohol, Philippines, that is cryptic with a Singaporean species, Raffles Bulletin of Zoology 68, pp. 441-447 : 443-446

Thinophilus reizlae , new species

( Figs. 3 , 4 , 6 A–C, 7A)

Material examined. Holotype: male. Philippines, Bohol, SAVIMA Mangrove. 9.730240°N, 123.853148°E, 03 September 2016; (specimen code UPLBMNH DIP-02425, collection code BohSW11 T1 _F32_ R78 ; conserved in ethanol, deposited at UPLB).

Paratype: 1 female, 9.729968°N, 123.853449°E; 16 July 2016; (specimen code ZRCENT00001019, collection code BohSW4 T2 _ F32_ R70 ; conserved in ethanol, deposited in ZRC) .

Diagnosis. Habitus-wise, Thinophilus reizlae , new species, is very similar in external morphology ( Figs. 3 , 4 ) to the Singaporean species T. comatus ( Fig. 5 ). The two morphological differences are mainly in the male terminalia as can be seen by comparing Fig. 6C vs. 6D and Fig. 7A vs. 7B. Firstly, in T. reizlae ( Fig. 6C ) the dorsal bristle (db) on the surstylus is much closer to the base of the apical fork of the surstylus as designated by the inner-lateral bristle (lb), being thinner than the width of the surstylus at the base of the apical fork (green measure); comparatively, in T. comatus ( Fig. 6D ) the distance is much larger, more than the thickness of the surstylus at the base of the apical fork (red measure). Secondly, in T. reizlae ( Fig. 7A ) the ventral apical border of the hypandrium (hyb) is a distinct pointed projection (green arrow), unlike in T. comatus ( Fig. 7B ), which is a weaker, rounded swelling (red arrow).

Etymology. The species is dedicated to Reizl Jose who helped with the survey of the dolichopodid flies of Bohol Island.

Description. Male (body 3 mm; wing 2.5 mm). Antenna yellow but brownish dorsally. Postpedicel heart-shaped, slightly taller than long. Lower postoculars white, uniseriate and not developed into a favoris (= ‘whisker’).

Scutum with 6 dc: first dc half as long as second, 4–5 equally long, prescutellar longest and lateral to the row. Upper and lower episternal bristles pale yellowish brown.

Legs yellow, all apical tarsomeres brown. Fore coxa with long black curved bristles on anterior side, with the basal bristle longer than coxa. Fore coxa yellow but darkened at base posteriorly, mid and hind coxae black. Fore femur with very long ventral bristles with wispy apices, basal one longest and almost four times as long as femur is wide; the bristles becoming shorter towards tip, but there still 2.5–3 times as long as femur is wide. Fore tibia ventrally with a double row of long fine bristles: bristles in the anterior row about twice as long as tibia is wide, those in the posterior (posteroventral) row more than three times as long as tibia is wide. This row is continuous onto tarsomeres 1–3. Mid femur with about five long black bristles ventromedially; shortest about 1–1.5 times as long as femur is wide; longest 2–2.5 times as long. Hind femur with only minute ventral bristles.

Wing brownish tinged. Haltere and calypter white.

Sternites with short but distinct black bristles.

Male terminalia as in Figs. 6 A–C, 7A. Surstylus long dark brown, well separated from the epandrial lobe that has a

thick apical bristle. Surstylus bifurcates near apex into two non-equal arms, with the distinctly shorter surstylar arm ventral and outer to the longer arm ( Fig. 7A ). The shorter arm bears two short bristles forming a ‘V’ ( Fig. 6C ) while the longer arm bears a pair of slender setae subapically and some minute papillae apically ( Fig. 7A ). At a short distance basal to the base of the surstylar fork there is a short, weak inner-lateral bristle (lb) followed shortly by a long fine dorsal bristle (db), and further down and closer to the epandrial lobe is a long fine ventral bristle (vb) ( Fig. 6C ). The hypandrial bridge, supposed to be the remnant of the hypandrium, bears a pointed projection medially ( Fig. 7A ). Cerci pale brownish, dorsally fused, delimitation of anus indistinct ( Fig. 6B ); set with pale long bristles on apical quarter while the bristles on the basal ¾ are brown and a little shorter.

Female ( Fig. 4 ) similar to male except for simple chaetotaxy on the legs and the terminalia.

Barcode. Cytochrome oxidase I (COI) partial-cds (313 bp; GenBank accession code MN609847 ) as follows: tatcagctggtattgcccatggaggagcatctgtagatctagctattttctcacttcatc ttgccggagtatcatcaattctaggagctgtaaattttattacaactgtaattaatatacg atcaaccggaattacatttgatcgtataccattatttgtttgatctgttgtaattacagcta ttttattattactttctctaccagttttagctggagctattacaatattattaactgaccgaa atctaaatacatcattctttgaccctgcaggaggaggggaccctattctctatcaacac ttattt---

Remarks. Both Thinophilus reizlae , new species, and T. comatus are superficially very similar in morphology and can only be distinguished by two small male-terminalia characters. Both characters were verified in four males of T. comatus that were dissected and proved to have negligible variation, i.e., we consider these characters stable within T. comatus , and that the difference in characters for T. reizlae to be species-level differences and not intraspecific variation. DNA taxonomy evidence ( Fig. 2 ) also show that T. reizlae is as a cluster with a significant 4.6% divergence from the Singaporean T. comatus population. Given that T. reizlae is morphologically and genetically distinct, they would constitute different species under all species concepts (see discussions under Ang & Meier, 2010, 2013; Tan et al., 2010; Rohner et al., 2014; Ang et al., 2017), and we here consider T. reizlae a new distinct species.

Figures

Fig. 3. Thinophilus reizlae, new species, holotype [specimen code UPLBMNH DIP-02425, collection code: BohSW11T1_F32_R78] male habitus. A, lateral view; B, dorsal view.

Fig. 4. Thinophilus reizlae, new species, paratype [specimen code ZRCENT00001019; collection code BohSW4T2_ F32_R70] female habitus. A, lateral view; B, dorsal view (separated head capsule in oblique view).

Fig. 6. A, Thinophilus reizlae, new species, holotype male terminalia lateral view; B, terminalia dorsal view; C, surstylus and epandrial lobe, lateral view; D, Thinophilus comatus Grootaert, surstylus and epandrial lobe, lateral view. Green and red measures indicate the distance between the distal (db) and inner lateral (lb) bristles for T. reizlae and T. comatus respectively. Abbreviations: db, dorsal bristle; el, epandrial lobe; lb, lateral bristle; sur, surstylus; vb, ventral bristle. Scales represent 0.1 mm.

Fig. 5. Thinophilus comatus Grootaert, 2018, male habitus, lateral view.

Fig. 7. A, Thinophilus reizlae, new species, holotype male terminalia ventral view; B, Thinophilus comatus Grootaert, male terminalia ventral view. Green and red arrows indicate the protrusions on the margin of the hypandrial bridge (hyb) for T. reizlae and T. comatus respectively. Abbreviations: db, dorsal bristle; el, epandrial lobe; hyb, hypandrial bridge; lb, lateral bristle; ph, phallus; sur, surstylus; vb, ventral bristle. Scale = 0.1 mm.

Fig. 2. Cluster dendrogram of COI (313 bp) barcodes of Thinophilus comatus from Singapore and T. reizlae, new species, from Bohol, Philippines. Objective clustering of barcodes was performed based on uncorrected p-distances using the ‘best close match’ criteria; the number at each ‘node’ represents the percentage divergence or pairwise distance threshold at which clusters split or lump together. Each cluster identified as a species is highlighted in one colour per respective species. Sequences of T. reizlae, new species, are highlighted in green, those of T. comatus in red.