Nematovomycetales Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Nematovomycetales Tedersoo & Esmaeilzadeh-Salestani ord. nov.

Type family.

Nematovomycetaceae Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 127–146 in N. soinasteënsis and S. cerevisiae atccggyaggtatacctatt or gcctgcaggtatacctattt or acgtgcaagtatacctattt; one mismatch allowed) and in LSU D 3 (positions 905–919 in N. soinasteënsis and 748–762 in S. cerevisiae : acccgatcctagctc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Nematovomycetes, covering sequences EUK 1137920 , EUK 1124402 , EUK 1124400 , AB 971072, EUK 1106088 , OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016 , EUK 1107129 , EUK 1102228 , EUK 1204135 , EUK 1124398 , EUK 1124395 , EUK 1124396 , EUK 1200775 , and EUK 1124397 (Fig. 1 ).

Notes.

Currently includes Nematovomycetaceae and another potentially family-level group represented by sequences EUK 1137920 (forest soil in Estonia), EUK 1202819 (grassland soil in Estonia), EUK 1113339 (lake water in Sweden), and EUK 1124400 (lake sediment in Estonia).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.