Borikenia Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Borikenia Tedersoo gen. nov.

Type species.

Borikenia urbinae Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1684–1703 in S. cerevisiae tgcggtccacatgttggcaa; one mismatch allowed) and ITS 2 (positions 26–45 in type species ttggtggacttggtcgttca; two mismatches allowed). Forms a monophyletic, least inclusive clade in Borikeniaceae, covering sequences EUK 1189254 , EUK 0530094 , and EUK 0530090 (Figs 1 , 51 ).

Notes.

Recognized based on eDNA sequences only. Comprises four potential species represented by sequences EUK 0530090 (forest soil in India), EUK 0530094 (forest soil in Colombia), and EUK 0530095 (forest soil in Costa Rica).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.

Figure 51. Maximum Likelihood SSU- ITS - LSU phylogram indicating the position of Borikenia urbinae within Borikeniomycota, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Members of various fungal phyla were used as an outgroup.