Micropterix vulcanica, Timossi, 2025

Timossi, Giovanni, 2025, Micropterix vulcanica sp. nov. (Lepidoptera, Micropterigidae) discovered on the island of Pantelleria (Italy, Sicily), Zootaxa 5683 (2), pp. 282-288 : 283-287

Micropterix vulcanica sp. nov.

Material studied. Holotype ♂: I, Sicilia, Pantelleria, Montagna Grande 1 609 m slm 36.46'514 N 11.59 '169E, 13.IV.2024 nighttime, legit Timossi G.; red label “TYPE Micropterix vulcanica Timossi G. 2025 ”: MSNG.

Paratype: 1♂ I, Sicilia, Pantelleria, Montagna Grande 1 609 m slm 36.46'514 N 11.59 '169E, 13.IV.2024 d nighttime, legit Timossi G., m. s. 2197 TG: RCTG .; 21 ♂, 2 ♀, idem, RCTG ; 2 ♂, idem, DAFFSPa ; 2 ♂, 2 ♀, idem, RCMK ; 4 ♀ I, Sicilia, Pantelleria, Montagna Grande 2 vetta 812 m slm 36°46'50"N 12°00'19"E, 11.V.2025 daytime, legit Timossi G., RCGT ; 3♂ 41♀ I, Sicilia, Pantelleria, Martingana 400 m slm 36.759291N 12.018736 E, 15.III.2024 daytime, legit Ruzzier E., RCER ; idem 3 ♂ m. s. 2190, 2191, 2192, 3 ♀ m. s. 2193, 2194, 2195 TG: RCTG; 1♂ I, Sicilia, Pantelleria, Montagna Grande 1 609 m slm 36.46'514 N 11.59 '169E, 26.II.2025 daytime, legit Lo Verde G.: DAFFSPa . All paratype with red label “ PARATYPE Micropetrix vulcanica Timossi G. 2025 ” .

Description. Adult (Pl. I fig. a–d). Forewing length ♂ 3,7–3,9 mm (n=31), ♀ mm 4,6–4,9 (n=48); Head black, vesture with yellow hair-like scales; antennae moniliform, dark brown ¾ ♂ and ½ ♀ long of the forewing length; thorax and tegulae golden; forewing: background color golden, silvery white band from the costa to the posterior margin at ¼ and ½ of the wing, at ¾ the band is of variable width and shape and does not reach the posterior margin of the wing: with the wings closed or adequate incidence of light a series of golden spots is visible also at the termen, golden fringes; hindwings with golden reflections especially at the apex, long brown fringes; abdomen brown with yellowish scales; legs covered with silvery scales. There are some variations in the background colour of the forewings which can be golden-bronze, the silver-white bands have variable width.

Male genitalia (Pl. II fig. a–h). Uncus long and wide, rounded apex with some fine bristles laterally, is present a long tuft of setae ventrally directed that originates from the proximal-ventral area of the uncus; accessory clasper little developed with 1–2 spinoid setae with rounded apex at the distal end, a series of 7–8 ventral setae with the anterior ones with rounded end; valves short, expanded in the proximal part with 2–3 long spines internally, tapered in the intermediate part, the distal end is expanded with 12–13 spines on the internal surface along the lower margin of the valve.

Female genitalia (Pl. II fig. i–m). Ovipositor short; tergite IX missing; sternite IX well sclerotized; short terminal papillae with hairs at the tips and no obvious diagnostic features; receptaculum seminis not diagnosed.

Molecular data. A full DNA barcode sequence 658 bp long was obtained (Lep_1_1631943) from a specimen collected in the same location as the holotype on 13.IV.2024. The GenBank accession number is PV891883.

AATTTTATATTTTTTATTTGGTATATGAAATGGATTAATTGGTATAATATTTAGAATATTAATTCGAATTGAATTA AGAATTCCAAATTATTTTTTAAATAATGATCAAATTTTTAATTTAATTATTACATCTCATGCATTTATTATAATTT TTTTTATAGTAATACCTATTTTAATTGGTGGGTTTGGAAATTGATTAGTTCCTTTAATATTAGGATCTCCTGATAT AGCTTTTCCTCGAATAAATAATTTAAGATTTTGATTATTACCTCCTTCAATTAATTTATTATTATTAAGATCATTT ATAGAATTAGGTACAGGAACAGGATGAACTATATATCCTCCTTTATCTAGAAGAATTTATCATAGAGGTATTTCAG TTGATTTAACTATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTTTAGGGGCTATTAATTTTATTTCTACTAT TATAAATATAAAAATTTATAATTTAAATTTTAATCAAGTTCCTTTATTTGTTTGATCAGTAAAAATTACTGCTTTA TTATTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCTT TTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATTTCAACATTTATTT

According to the BOLD Identification Engine, the most similar sequences belong to Micropterix trinacriella at a distance comprised between 3.23% (BOLD sequence page MICOW090-09) and 3.42% (BOLD sequence page BCLEP694-23). However, on the neighbour-joining tree generated by the function “tree based identification”, the first dichotomy separates Micropterix vulcanica sp. nov. from M. isobasella Staudinger, 1871 (distance 3.95%) and M. stuebneri Zeller, Werno & Kurz, 2013 (distance 4.02%).

Distribution. Known from the island of Pantelleria where it has been found in various locations (map fig. 1).

Life history. The early stages are unknown. The new species has been observed flying during the day from late February to mid-May in a single prolonged generation. The first flights occur in low altitude locations and in May on the summit of Montagna Grande. The species has been observed on the flowers of Erica arborea Linnaeus, 1753 , Cistus sp. , Quercus ilex Linnaeus, 1753 , Pinus pinaster Aiton, 1789 , and Genista sp .. It is also attracted to artificial light. The known larvae of the species of the genus Micropterix need humidity in the soil and feed on hyphae of fungi and unicellular algae ( Zeller-Lukashort et al., 2007). In Pantelleria, the habitat is the Mediterranean scrub, a very dry environment with little rainfall, apparently unsuitable for the larval development of Micropterix , but there are numerous active vents (fumaroles) from which water vapours come out, creating a constantly humid habitat nearby where the larvae could live.

Etymology. The name of the new species refers to the genesis of the island of Pantelleria caused by a volcanic eruption about 324,000 years ago.

Diagnosis. The species phylogenetically closest to M. vulcanica are M. stuebneri known from Spain, and M. isobasella known from the western Alps of Switzerland and Italy. It can be easily distinguished from both by the wing pattern and the male genitalia, which in M. vulcanica have a long uncus, the long tuft of ventral bristles and by the shape of the valves. Furthermore, the habitat is different. Micropterix vulcanica can also be distinguished from the other congeneric species present in Sicily by the wing pattern and the male genitalia. In particular, it can be distinguished from M. uxoria by the tuft of ventral bristles of the uncus and the accessory clasper.

Remarks. In the current methodology for Lepidopteran DNA barcoding, a hind leg or other part of the specimen destined to become the holotype or paratype is usually sacrificed. Sequences that fail and are not usable are frequent, especially in Micropterigidae ( La Cava & Scalercio 2025) . Contrary to what is now the practice in the description of new species of Lepidoptera , for Micropterix vulcanica the first sequence studied is “naked”: we define it as a sequence devoid of any physical part of the specimen from which the sequence was extracted. The sequence is therefore published in this work and is deposited in GenBank.

Conclusions. The entomological exploration of the Lepidoptera of the island of Pantelleria began in 1875 by Enrico Ragusa (1875) who first provided a list of 21 species of butterflies and moths. 150 years after that first expedition, this is the first report for the family Micropterigidae and for the genus Micropterix from Pantelleria. A provisional inventory of the Lepidoptera species known from Pantelleria counts 152 entities ( Timossi et al., 2025) and confirms the poor knowledge of the species diversity for this island that presents a remarkable vegetation diversity. It is not an exception to find “endemic” species on Pantelleria: 18 species of insects are known that are mistakenly considered neoendemic ( Muscarella & Baragona, 2017); in fact, in Pantelleria, due to the continuous volcanic activity, which had its maximum about 45,000 years ago with an explosive eruption that completely covered the island with green ignimbrite ( Agnesi & Federico, 1995) and that destroyed the original flora and fauna, the biodiversity of the island of Pantelleria is the result of recolonization from North Africa, Sicily and the Middle East. The short times between one destructive eruptive event and another would not have allowed the evolution of native endemics. It is much more likely that the lepidopteran fauna of Pantelleria is composed of elements arrived by chance through spontaneous migration and as components of the aeroplankton ( Massa, 1995) as demonstrated by some recent findings such as Thaumetopoea mediterranea Trematerra & Scalercio, 2017 ( Notodontidae ) also known from Tunisia, and Anomalotinea cossyrella Barberis & Nel, 2023 ( Tineidae ) which is known exclusively from Pantelleria, Micronola wadicola Amsel, 1935 with an eastern distribution ( Timossi et al., 2024), and Chesias plumbeata Staudinger, 1901 ( Timossi et al., 2025) with a North African distribution. Pantelleria is approximately 70 kilometers from the coast of Tunisia (Cape Bon) whose known Micropterigidae fauna includes two species: Micropterix cartaginensis Heath, 1986 and Micropterix jacobella Walsingham, 1901 . These species were studied by Heath in 1986 who was the first to publish their male genitalia and wing pattern. They do not share either the wing pattern or the male genitalia with the new species described here ( Heath 1986 fig. 10, 11, 17, 18). Among the known North African species, M. vulcanica resembles Micropterix lambesiella Viette 1949 in terms of male genitalia, with which it shares the tuft of setae ventral to the uncus ( Heath 1986 fig. 19, 20). Among the North African species, Micropterix chyaneochrysa Walsingham 1907 described based on a female and a male without abdomen collected in Algeria ( Heath 1986 fig. 15) is not adequately represented, and its specific status remains to be verified, but its wing pattern is not that of the new species described here. DNA barcodes are not known for the North African species.

The island of Pantelleria is hit by strong winds for many days a year, sirocco and mistral with a direction from the south-east and north-west respectively, which blow throughout the Mediterranean basin, and are presumably responsible for the transport of Lepidoptera (and other animal and plant organisms) that find in the Strait of Sicily the only obstacle in the island of Pantelleria and its main relief of Montagna Grande, 836 m above sea level, which intercepts the aeroplankton ( Massa, 1995). The Italian fauna of Micropterigidae with the discovery of Micropterix vulcanica sp. nov. has now 35 species while the European one has 52 species.