Chthonolpidiaceae Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Chthonolpidiaceae Tedersoo fam. nov.

Type genus.

Chthonolpidium Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 142–154 in type species and 143–155 in S. cerevisiae tgttcgacaycc; one mismatch allowed) and LSU D 2 (positions 695–714 in type species and 604–623 in S. cerevisiae gactgcttgcaggctgcata; one mismatch allowed). Forms a monophyletic, least inclusive clade in Chthonolpidiales, covering sequences EUK 1124876 , EUK 0534797 , EUK 0534798 , EUK 0534818 , EUK 1191212 , and EUK 1138033 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Includes Chthonolpidium (gen. nov.) and potentially other genera represented by sequences EUK 1191212 (forest soil in Puerto Rico), EUK 0534797 (urban soil in China), EUK 0534798 (grassland soil in Norway), and EUK 0534818 (forest soil in Colombia).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.