Hyalessa wangi, Wang & Qiu & Wei, 2016

Wang, Xu, Qiu, Yue & Wei, Cong, 2016, A new species of the genus Hyalessa (Hemiptera, Cicadidae) from China, with DNA barcoding data and a key to related species, Zootaxa 4085 (2) : -

publication ID	https://doi.org/ 10.11646/zootaxa.4085.2.10
publication LSID	lsid:zoobank.org:pub:829C8A80-424A-427B-9560-262C5F06950C
DOI	https://doi.org/10.5281/zenodo.6056307
persistent identifier	https://treatment.plazi.org/id/92667569-1F4D-ED35-BBE0-FF28FE5A3A51
treatment provided by	Plazi
scientific name	Hyalessa wangi
status	sp. nov.

Treatment

Hyalessa wangi View in CoL sp. nov.

Figs. 1–2 View FIGURE 1 View FIGURE 2

Type material. Holotype: ♂ ( NWAFU), China: Daxueshan Nature Reserve (24°01’30”N, 99°15’15”E), Yongde County, Lincang City , Yunnan Prov., 2000m, 22.VIII.2015, coll. Jishen Wang GoogleMaps . Paratype: 1 ♂ ( NWAFU), same data as the holotype GoogleMaps .

Measurements of types (in mm). (2 ♂♂): Body length: 27.18–27.68; fore wing length: 45.50–46.51; fore wing width: 15.04–15.08; width of head including eyes: 9.20–9.26; pronotum width (including pronotal collar): 13.36–13.39; mesonotum width: 11.21–11.23.

Etymology. The species name is named after the collector.

Description of male. Head ( Fig. 1A–C View FIGURE 1 ) mostly green, about 0.69 times as wide as pronotum. Compound eye greenish brown; ocelli green. A median inverted trianglular black marking enclosing ocelli area; pair of black, linear markings along frontoclypeal suture. Supra-antennal plate black. Postclypeus moderately swollen, with a green medial longitudinal fascia and black transverse grooves on each side. Lorum black covered with golden pile. Anteclypeus green with pair of black markings posterior. Rostrum black and reaching half-length of abdominal sternite II.

Thorax ( Fig. 1A–C View FIGURE 1 ). Pronotum green and slightly longer than head, with pair of central broad longitudinal black fasciae widened both anteriorly and posteriorly; pair of large reddish fasciae along lateral fissure. Pronotal collar generally green with some irregular, black markings. Mesonotum black with large areas of irregular, green markings anteriorly; pair of faint green spots on scutal depressions. Cruciform elevation black, with pair of green markings on anterior angles. Metanotum and lateral part of cruciform elevation green to black with golden pile. Thoracic sternites green to black.

Legs ( Fig. 1E View FIGURE 1 ). Black; fore femur with large ochraceous patch medially and longitudinal ochraceous patch along posterior margin in lateral view. Fore tibia and mid femur mostly black. Hind legs mostly black. Fore femur with primary spine short and oblique to femur, secondary spine erected and pointed, subapical spine absent.

Wings ( Fig. 1A, B View FIGURE 1 ). Hyaline; fore wing pale brown with distinct large fuscous spot at bases of second, third, fifth, and seventh apical cells; a marginal series of minute pale fuscous spots near apices of longitudinal veins in apical cells. Costa vein and R+Sc vein reddish brown to black. Basal membrane dark green. Hind wing not tinged.

Abdomen ( Fig. 1A–D View FIGURE 1 ). Mostly black; abdominal tergite III with indistinct green posterior margin. Timbal cover black, circular and globose. Operculum black, overlapping to the other one centrally, with rounded apex not reaching posterior margin of abdominal sternite II. Abdominal sternites black, with posterior margins green.

Genitalia ( Fig. 1F–H View FIGURE 1 ). Pygofer nearly elliptical, covered with long hairs in ventral view. Anal styles brownish yellow. Basal lobes of pygofer not developed. Distal shoulder rounded. Uncal lobes black basally and yellow apically, long and flat, with rounded apices well separated from each other from near base in ventral view. Aedeagus thick, large medial saccate hook tapered and curved subapically, protruding from near base of uncal lobes; a pair of highly sclerotized lateral processes extending from base of aedeagus very long and thin, with apices curved cephalad in lateral view, which are nearly completely overlapped by the uncal lobes in situ.

Female. Unknown.

Distribution. China (Yunnan).

Habitat. This new species was collected from a mountain valley at elevation of 2000 m. The microhabitat is among evergreen broad-leaved forests with dense herbaceous groundcover. Individuals were observed sitting and singing on high trees (e.g., Rhododendron delavayi Franch , Cyclobalanopsis stewardiana var. longicaudata Hsu, Mao & Li and Schim a argenti Pritz) ( Fig. 2 View FIGURE 2 ).

Molecular Characters. Partial mitochondrial COI gene sequence with GenBank accession number: KT989869 View Materials . Material: 1 ♂, Yunnan, Lincang , Yongde , Daxueshan Nature Reserve , 2000m, 22.VIII.2015 (coll. Jishen Wang).

GATTGCATTCATTTTTGGATTTGATCAGGGATGATTGGTACATCTTTAAGAATATTAATTCGAATTGAGT TAGGAACTCCTGGTTCCTTTATTGGTAATGATCAAATTTATAATGTTATTGTTACAGCTCATGCATTTATT ATAATTTTTTTTATAGTTATGCCTATCATAATTGGGGGTTTTGGAAATTGGCTTATTCCTTTAATAATTGG AGCCCCAGATATAGCGTTTCCTCGAATAAATAATATGAGTTTTTGATTACTTCCTCCTTCTTTAACTTTAT TGATAATTGGTATAATAGTTGATAGAGGGGCTGGTACTGGTTGAACAGTTTATCCTCCATTATCAAGTAC TATATCTCATTCTGGAGCTTGTGTAGATTTAACAATTTTTTCTTTACATTTGGCAGGTGTATCTTCAATTT TAGGGGCTGTAAATTTTATTAGAACAATTTTTAATATGCGTGCAATTGGTATGTATTTGGATCGAACACC TTTATTTGTATGAGCAGTGTTAATTACTGCTTTTCTTTTATTGTTATCATTGCCAGTTCTGGCTGGGGCTA TTACTATATTATTAACAGATCGAAATATAAATACTTCTTTTTTTGACCCATCAGGTGGGGGAGATCCAAT TCTTTATCAGCATTTAT

Remarks. This new species is similar to H. stratoria in body size, but can be distinguished by the coloration and shape of timbal covers and opercula. This new species is also similar to H. maculaticollis in the shape of timbal covers and opercula, but can be distinguished by the markings on thorax, the coloration of uncal lobes and the shape of aedeagus. This new species is also similar to H. expansa in the uncal lobes being separated from each other from near their base, but can be distinguished by the rounded apices of the uncal lobes (uncal lobes with apices pointed in H. expansa). This new species is unique in the genus Hyalessa due to the following two characteristics: 1) fore femur possesses only the primary and secondary spines, without subapical spine; and 2) aedeagus with a pair of very long and sclerotized lateral processes.

Currently, Hyalessa species lack any barcode records in GenBank. We obtained a partial mitochondrial cytochrome oxidase subunit I (COI) sequences (DNA barcoding) of H. wangi sp. nov., and submitted it to GenBank. This will be helpful for molecular identification and phylogeny reconstruction of Hyalessa species, which will be treated elsewhere.