Palomastigales Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Palomastigales Tedersoo ord. nov.

Type family.

Palomastigaceae Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 8 (positions 1664–1678 in S. cerevisiae tttagtgaggactcg; no mismatch allowed) and 5.8S (positions 116–135 in type species and S. cerevisiae gcctcccggtattccaggag or gcttcatggtattccgtga; one mismatch allowed). Forms a monophyletic, least inclusive clade in Palomastigomycetes, covering sequences EUK 1124846 , EUK 1123686 , EUK 0320705 , and EUK 0320700 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Currently includes Palomastigaceae (fam. nov.).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.