Bowie ninhbinh S. Li & Yao, 2022

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

Bowie ninhbinh S. Li & Yao sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Bowie ; Location : country: Vietnam; stateProvince: Ninh Binh; verbatimLocality: Cuc Phuong National Park ; verbatimElevation: 158 m a.s.l.; verbatimLatitude: 20°15.006'N; verbatimLongitude: 105°42.895'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2015; month: 8; day: 19; Record Level: institutionCode: IZCAS-Ar 43542 Type status: Paratype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Bowie ; Location : country: Vietnam; stateProvince: Ninh Binh; verbatimLocality: Cuc Phuong National Park ; verbatimElevation: 158 m a.s.l.; verbatimLatitude: 20°15.006'N; verbatimLongitude: 105°42.895'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2015; month: 8; day: 20; Record Level: institutionCode: IZCAS-Ar 43543

Description

Male (IZCAS-Ar 43542): PL 7.6, PW 5.9, AW 3.0, OL 5.8, OW 3.9. Eye diameters and interdistances: AME 0.26, ALE 0.19, PME 0.38, PLE 0.30, AME-AME 0.19, AME-ALE 0.29, PME-PME 0.22, PME-PLE 0.43, AME-PME 0.18, ALE-PLE 0.23, clypeus AME 0.11, clypeus ALE 0.55. Palp and leg measurements: palp 7.8 (2.7, 1.2, 1.3, -, 2.6), I 21.3 (5.6, 3.0, 5.8, 4.9, 2.0), II 19.6 (5.3, 2.7, 5.1, 4.7, 1.8), III 15.9 (4.3, 2.5, 3.4, 4.1, 1.6), IV 23.1 (5.9, 2.5, 5.7, 7.0, 2.0). Leg formula 4123. Spination of palp and legs: palp 151, 100, 101; femora I p021, d111, r112, II p112, d111, r112, III p212, d111, r112, IV p112, d111, r012; patellae I-IV 101; tibiae I p110, d111, r210, v22222, II p110, d111, r110, v22222, III p11, d200, r11, v222, IV p11, d111, r11, v222; metatarsi I-III p112, d010, r112, v222, IV p112, d010, r112, v2222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 19 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 6 bristles. Ventral tarsi and metatarsi I-II with sparse scopula. Right leg claws I-III with 2 and IV with 3 secondary teeth. Position of tarsal organ: I 1.27, II 1.28, III 1.06, IV 1.36.

Palp (Fig. 17 a-c). RTA arising from tibia subdistally, stout and distally bifurcated. Cymbium tip slightly conical, with retro-proximally outgrowth. Embolus (Fig. 28 b) arising at 7.30 o’clock position, its tip wide and blunt, situated in distal half of tegulum. Conductor arising at 12 o’clock position. Tegular apophysis arising subcentrally from tegulum, nearly round.

Colour (Fig. 18 a and b). Reddish-brown to yellowish with dark patterns. Dorsal prosoma with characteristic lighter median band, widened behind eyes and with some white hairs, distinctly marked fovea and indistinct radial markings. Sternum and ventral coxae yellowish, labium brown and gnathocoxae brown with dark patterns. Chelicerae reddish-brown with longitudinal lines. Legs reddish brown-yellowish. Dorsal opisthosoma yellowish with black patches. Lateral opisthosoma yellowish with darker spots. Ventral opisthosoma yellowish with dark patterns; epiandrium and muscle sigilla light. Spinnerets and anal tubercle light.

Female

Unknown.

Variation: Paratype male (IZCAS-Ar 43543): PL 7.4, OL 5.7.

Diagnosis

Medium-sized Ctenidae (total length male 13.1-13.4). The new species is assigned to the robustus -species group with the characteristics of stout tegular apophysis, simple stout embolus with broad base, presence of retro-proximal cymbial outgrowth and RTA arising subdistally from palpal tibia. It resembles B. dodo Jäger, 2022 (see Jäger 2022: figs 241-243 and 267-268) by having similar conductor, broad embolus and retro-proximal cymbial outgrowth (Fig. 17 a-c and Fig. 28 b), but can be distinguished by the tegular apophysis nearly round and without concave (Fig. 17 b, tegular apophysis with distinct concave on retrolateral side in B. dodo ) and by the RTA distally bifurcated (Fig. 17 b, RTA having no bifurcation in B. dodo ).

Etymology

The specific name refers to the type locality and is a noun in apposition.

Distribution

Vietnam (Ninh Binh, type locality; Fig. 1 ).

DNA Barcode

Male (IZCAS-Ar 43542):

TACTTGGATCTTGGGCTGCTATGGCAGGGACAGCTATAAGAGTATTAATTCGGATGGAATTAGGCCATTCTGGGAGATTGTTAGGTGATGATCATTTATACAATGTAATTGTTACTGCACATGCTTTTGTAATGATTTTTTTTATAGTAATGCCTATTTTAATTGGGGGTTTTGGAAATTGGTTAGTACCTTTGATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTGTCTTTTTGGTTACTTCCTCCTTCGTTATTTTTATTATTTATATCTTCAATAGTTGAGATAGGAGTTGGAGCTGGATGAACGGTATATCCTCCTTTAGCTTCTAGTATTGGTCATATAGGGAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCTTCTTCTATTATAGGAGCGGTAAATTTTATTTCTACGATTATTAATATGCGTTTGTATGGGATGACTATAGAGAAAGTACCTTTATTTGTGTGATCTGTTTTAATTACTGCGGTATTGTTATTATTGTCTTTACCTGTTTTAGCAGGTGCTATTACTATATTGTTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCGGCTGGGGGTGGTGATCCTGTTTTGTTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572110).

Figures

Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n.

Figure 17. Bowie ninhbinh sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, E = embolus, RPO = retro-proximal cymbial outgrowth, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c).

Figure 18. Bowie ninhbinh sp. n., habitus, holotype male. a: Dorsal view; b: Ventral view. Scale bar: 2.0 mm (a, b).