Savannolpidiales Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Savannolpidiales Tedersoo & Esmaeilzadeh-Salestani ord. nov.

Type family.

Savannolpidiaceae Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in the ITS 2 - LSU interface (LSU positions – 2–18 in type species and S. cerevisiae aagtgatctgaaatcagaca; two mismatches allowed) and SSU V 8 (positions 1589–1608 in S. cerevisiae atgattcatcagatcatgct; two mismatches allowed). Forms a monophyletic, least inclusive clade in Savannolpidiomycetes, covering sequences EUK 1191209 , EUK 1191210 , EUK 0534704 , EUK 1124874 , EUK 1701673 , EUK 1701672 , and EUK 1124875 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Currently includes Savannolpidiaceae (fam. nov.).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.