Sedimentomastix tueriensis Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Sedimentomastix tueriensis Tedersoo sp. nov.

Diagnosis.

Separation from other species of Sedimentomastix based on ITS 2 (positions 15–34 ctaaaagtcgggtttgattt; one mismatch allowed) and LSU D 2 (positions 572–591 gaaacaatggataaagggca; one mismatch allowed) as indicated in Fig. 26 . Intraspecific variation up to 1.7 % in ITS 2. Interspecific distance> 15 % in ITS 2.

Type.

Wastewater sample TUE 032723 ( holotype); eDNA sequence EUK 1152060 = OZ 253798 ( legitype); eDNA sample TUE 132723 ( nucleotype), Türi , Estonia, 58.8156°N, 25.4067°E .

Description.

Other sequences: EUK 0302143 ( Populus tremula forest soil in Soinaste, Estonia, 58.3408°N, 26.6864°E); EUK 0584897 (FunAqua stream water sample in Kangilleq, Greenland, 60.8571, –46.4233); EUK 0584898 (FunAqua river water sample W 0597 w in Aveleda, Portugal, 41.8919, –6.6972); and EUK 0584899 (FunAqua lake sediment sample W 0307 s in Goldwin, ND, USA, 47.0996, –99.0916).

Etymology.

Sedimentomastix refers to sedimentum (the Latin term for sediment) and Neocallimastix; the epithet refers to Türi (Estonian), the type locality.

Notes.

Found in water, sediment, and soil samples in Europe and North America (n = 5 records). GlobalFungi includes nine additional records, mainly from wetland soils in Europe, Asia, and North America.

Figures

Figure 26. Diagnostic nucleotide sequences of Sedimentomastix tueriensis relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).