Mycosocceriales Tedersoo, Bahram & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Mycosocceriales Tedersoo, Bahram & Esmaeilzadeh-Salestani ord. nov.

Type family.

Mycosocceriaceae Tedersoo, Bahram & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other species of Mortierellomycota based on diagnostic nucleotide signature in SSU V 9 (positions 1654–1663 in S. cerevisiae gattgaacgg; no mismatch allowed) and from all fungi in LSU D 2 (positions 573– 92 in the type species and 521–540 in S. cerevisiae aagttggaggaatgtggctc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Mortierellomycetes, covering sequences EUK 0531595 , EUK 1102426 , EUK 1202279 , EUK 0531631 , EUK 1008618 , and EUK 1124462 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Encoded as clade GS 61 in EUKARYOME v 1.9. Currently includes Mycosocceriaceae (fam. nov.). Comprises potentially 20–30 species. Detected in soil (93.2 % out of the 74 records) and sediments (6.8 %) in cold temperate to hot tropical biomes across all continents except Antarctica.

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.