Edaphochytriomycetes Tedersoo

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Edaphochytriomycetes Tedersoo class. nov.

Type order.

Edaphochytriales Tedersoo .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 45–64 in type species and S. cerevisiae catagtgaaatgtgataact or catggtgaaatgtgacaatt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Chytridiomycota, covering sequences EUK 1104126 , EUK 1107474 , EUK 1671450 , EUK 1671451 , EUK 1008462 , EUK 1200051 , EUK 1101631 , EUK 1101779 , EUK 1200763 , and EUK 1123748 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Encoded as clade GS 42 in EUKARYOME v 1.9. Currently harbors Edaphochytriales (ord. nov.) and potentially an order-level group represented by sequences EUK 1104126 (lake water in Sweden) and EUK 1107474 (peatland soil in Sweden). Comprises potentially 40–45 species. Detected in soil (94.4 % out of the 89 records), sediments (2.2 %), glacial ice (2.2 %), and freshwater (1.1 %) in tundra to wet tropical biomes across all continents except Antarctica.

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.