Amauropelma saraburi S. Li & Yao, 2022

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

Amauropelma saraburi S. Li & Yao sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Amauropelma ; Location : country: Thailand; stateProvince: Saraburi; verbatimLocality: Kaeng Khoi District , Song Khon Village , Tham Bo Pla Cave ; verbatimElevation: 73 m a.s.l.; verbatimLatitude: 14°39.625'N; verbatimLongitude: 100°58.115'E; Event: year: 2014; month: 10; day: 20; Record Level: institutionCode: IZCAS-Ar 43533 Type status: Paratype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: female; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Amauropelma ; Location : country: Thailand; stateProvince: Saraburi; verbatimLocality: Kaeng Khoi District , Song Khon Village , Tham Bo Pla Cave ; verbatimElevation: 73 m a.s.l.; verbatimLatitude: 14°39.625'N; verbatimLongitude: 100°58.115'E; Event: year: 2014; month: 10; day: 20; Record Level: institutionCode: IZCAS-Ar 43534 Type status: Paratype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: female; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Amauropelma ; Location : country: Thailand; stateProvince: Saraburi; verbatimLocality: Kaeng Khoi District , Song Khon Village , Tham Bo Pla Cave ; verbatimElevation: 73 m a.s.l.; verbatimLatitude: 14°39.625'N; verbatimLongitude: 100°58.115'E; Event: year: 2014; month: 10; day: 20; Record Level: institutionCode: IZCAS-Ar 43535

Description

Male (IZCAS-Ar 43533): PL 4.5, PW 3.7, AW 1.6, OL 3.2, OW 2.1. Eye diameters and interdistances: AME 0.12, ALE 0.14, PME 0.14, PLE 0.14, AME-AME 0.07, AME-ALE 0.16, PME-PME 0.08, PME-PLE 0.26, AME-PME 0.07, ALE-PLE 0.13, clypeus AME 0.16, clypeus ALE 0.28. Palp and leg measurements: palp 5.2 (1.8, 0.8, 0.9, -, 1.7), I - (4.5, 2.0, 4.5, 4.0, -), II 15.2 (3.8, 2.1, 3.8, 3.7, 1.8), III 14.3 (3.6, 1.8, 3.4, 3.7, 1.8), IV 19.4 (4.9, 2.0, 4.6, 5.6, 2.3). Leg formula 4123. Spination of palp and legs: palp 131, 100, 210; femora I p112, d111, r111, II p211, d111, r211, III p112, d111, r112, IV p112, d111, r002; patellae I 001, II-IV 101; tibiae I p010, r110, v22222, II p100, r100, v22222, III-IV p11, d111, r11, v222; metatarsi I v222, II p110, r110, v222, III p112, d010, r112, v222, IV p112, d010, r112, v2222. Chelicerae with 3 promarginal, 4 retromarginal teeth, without denticles. Retromargin of chelicerae close to fang base without bristle. Claw tufts arising separately, but intermingle with each other distally. Leg claws II with 1 and III-IV with 2 secondary teeth. Position of tarsal organ: IV 1.58.

Palp (Fig. 6 a-c). Patella with distinct retrolateral apophysis. Cymbium tip conical, with prolatero-proximal outgrowth and retro-proximal outgrowth. Embolus (Fig. 9 b) slender, arising at 8.30 o’clock position. Conductor arising at 1 o’clock position. Tegular apophysis large and longitudinally elongated, with excavation on prolateral side.

Colour (Fig. 7 c and d). Yellowish-brown. Dorsal prosoma yellowish with eyes marked with black rings, fovea distinct, brown. Sternum, ventral coxae, labium and gnathocoxae yellowish without patterns. Chelicerae brown. Legs yellowish. Dorsal opisthosoma yellowish without patterns. Lateral and ventral opisthosoma grey without patterns. Spinnerets grey.

Female (IZCAS-Ar 43534): PL 5.6, PW 4.4, AW 2.8, OL 4.9, OW 3.1. Eye diameters and interdistances: AME 0.14, ALE 0.20, PME 0.15, PLE 0.16, AME-AME 0.12, AME-ALE 0.32, PME-PME 0.16, PME-PLE 0.53, AME-PME 0.08, ALE-PLE 0.20, clypeus AME 0.13, clypeus ALE 0.21. Palp and leg measurements: palp 6.0 (1.7, 1.2, 1.4, -, 1.7), I 19.3 (4.6, 2.7, 5.6, 4.2, 2.2), II 18.3 (4.9, 2.5, 5.0, 4.0, 1.9), III 17.0 (4.6, 2.2, 4.1, 4.3, 1.8), IV 23.0 (5.8, 2.4, 5.5, 6.6, 2.7). Leg formula 4123. Spination of palp and legs: palp 131, 100, 1111, 2112; femora I p021, d111, r111, II-III p112, d111, r112, IV p112, d111, r002; patellae I-II 000, III-IV 101; tibiae I -II v22222, III-IV p11, d111, r11, v222; metatarsi I-II v222, III-IV p112, d010, r112, v222. Chelicerae with 3 promarginal, 4 retromarginal teeth, without denticles. Retromargin of chelicerae close to fang base without bristle. Sparse scopula restricted almost entirely to tarsi, only metatarsi I-II with sparse scopula hairs. Claw tufts arising separately, but intermingle with each other distally. Palpal claw with 3 secondary teeth, leg claws I with 3, II-III with 2 secondary teeth.

Copulatory organ (Fig. 7 a, b, Fig. 8 a and b). Epigynal plate width/length: 19.5/8.6; anterior width/posterior width: 15/6.3; with lateral wings and posterior part with distinct lateral margins and two distinct tubercles. Lateral teeth pointing anteriorly. Internal duct system with round spermathecae not fully visible and spermathecae separated from each other by more than their diameter; fertilisation ducts elongate and laminar, pointing postero-medially.

Colour (Fig. 7 e and f). Reddish-brown to yellowish. Dorsal prosoma slightly reddish-brown with eyes marked with black rings, fovea distinct, reddish-brown. Sternum and ventral coxae yellowish without patterns; labium and gnathocoxae reddish-brown without patterns. Chelicerae reddish-brown. Legs yellowish-brown. Dorsal and lateral opisthosoma grey without patterns. Ventral opisthosoma yellowish without patterns. Spinnerets yellowish.

Variation: Second paratype female (IZCAS-Ar 43535): PL 4.6, OL 4.7.

Diagnosis

Small to medium-sized Ctenidae (total length male 7.7, female 9.3-10.5). The new species can be distinguished from all known congeners by the embolus slender (Fig. 6 b and Fig. 9 b), by the tegular apophysis large and longitudinally elongated, with excavation on prolateral side (Fig. 6 a-c), by the epigynal field wider than long, with lateral wings and distinct lateral margins (Fig. 7 a and Fig. 8 a) and by the lateral teeth pointing anteriorly (Fig. 7 a and Fig. 8 a).

Etymology

The specific name refers to the type locality and is a noun in apposition.

Distribution

Thailand (Saraburi, type locality; Fig. 1 ).

DNA Barcode

Male (IZCAS-Ar 43533):TGTTTGGAGCTAGATCTGCTATAGCGGGAACGGCAATAAGAGTTTTAATTCGTATGGAATTAGGAAATTCTGGAAGATTATTAGGGGATGATCATTTATATAATGTAATTGTGACAGCTCATGCTTTTATTATGATTTTTTTTATAGTAATACCGATTTTGATTGGTGGTTTTGGAAATTGATTAGTGCCTTTAATGTTAGGAGCTCCTGATATATCTTTTCCTCGGATGAATAATTTGTCTTTTTGATTACTTCCACCTTCTTTGTTTTTATTATTCATATCTTCTATGGTGGAAATGGGTGTAGGAGCTGGATGAACTGTTTATCCACCTTTGGCTTCTAGAATTGGTCATGCTGGAAGATCTATGGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCTTCAATTATAGGAGCGGTGAATTTTATTTCTACTATTATTAATATACGATTATCTGGAATAAGAATGGAGAAGGTTCCATTATTTGTTTGATCTGTTCTTATTACTGCAATTTTATTATTATTATCTTTGCCGGTATTAGCTGGTGCTATTACTATATTGTTGACTGATCGAAATTTTAATACTTCTTTTTTTGATCCGGCTGGGGGAGGGGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572100).

Female (IZCAS-Ar 43534):TGTTTGGAGCTTGATCTGCTATAGCGGGAACGGCAATAAGAGTTTTAATTCGTATGGAATTAGGAAATTCTGGAAGATTATTAGGGGATGATCATTTATATAATGTAATTGTGACAGCTCATGCTTTTATTATGATTTTTTTTATAGTAATACCGATTTTGATTGGTGGTTTTGGAAATTGATTAGTGCCTTTAATGTTAGGAGCTCCTGATATATCTTTTCCTCGGATGAATAATTTGTCTTTTTGATTACTTCCACCTTCTTTGTTTTTATTATTCATATCTTCTATGGTGGAAATGGGTGTAGGAGCTGGATGAACTGTTTATCCACCTTTGGCTTCTAGAATTGGTCATGCTGGAAGATCTATGGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCTTCAATTATAGGAGCGGTGAATTTTATTTCTACTATTATTAATATACGATTATCTGGAATAAGAATGGAGAAGGTTCCATTATTTGTTTGATCTGTTCTTATTACTGCAATTTTATTATTATTATCTTTGCCGGTATTAGCTGGTGCTATTACTATATTGTTGACTGATCGAAATTTTAATACTTCTTTTTTTGATCCGGCTGGGGGAGGGGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572099).

Figures

Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n.

Figure 6. Amauropelma saraburi sp. n., flipped right palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, E = embolus, PCO = prolatero-proximal cymbial outgrowth, RPA = retrolateral patellar apophysis, RPO = retro-proximal cymbial outgrowth, TA = tegular apophysis. Scale bar: 0.5 mm (a-c).

Figure 7. Amauropelma saraburi sp. n. a: Paratype female, epigyne, ventral view; b: Same, vulva, dorsal view; c: Holotype male, habitus, dorsal view; d: Same, habitus, ventral view; e: Paratype female, habitus, dorsal view; f: Same, habitus, ventral view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 1.0 mm (c-f).

Figure 8. Amauropelma saraburi sp. n., paratype female. a: Epigyne, ventral view; b: Vulva, dorsal view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b).