Anahita popa Jaeger & Minn, 2015

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

Anahita popa Jaeger & Minn, 2015

Materials

Type status: Other material. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Anahita ; Location : country: Myanmar; stateProvince: Mandalay; verbatimLocality: Sagaing Hill ; verbatimElevation: 168 m a.s.l.; verbatimLatitude: 21°58.595'N; verbatimLongitude: 95°59.198'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2017; month: 9; day: 27; Record Level: institutionCode: IZCAS-Ar 43538 Type status: Other material. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: female; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Anahita ; Location : country: Myanmar; stateProvince: Mandalay; verbatimLocality: Sagaing Hill ; verbatimElevation: 168 m a.s.l.; verbatimLatitude: 21°58.595'N; verbatimLongitude: 95°59.198'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2017; month: 9; day: 27; Record Level: institutionCode: IZCAS-Ar 43539

Description

Male (IZCAS-Ar 43538): PL 3.3, PW 2.7, AW 0.9, OL 3.3, OW 1.8. Eye diameters and interdistances: AME 0.14, ALE 0.12, PME 0.22, PLE 0.17, AME-AME 0.08, AME-ALE 0.23, PME-PME 0.16, PME-PLE 0.21, AME-PME 0.18, ALE-PLE 0.13, clypeus AME 0.10, clypeus ALE 0.55. Palp and leg measurements: palp 3.9 (1.4, 0.6, 0.8, -, 1.1), I 15.4 (3.7, 1.6, 4.3, 3.8, 2.0), II 12.7 (3.4, 1.4, 3.3, 3.1, 1.5), III 11.0 (2.9, 1.2, 2.6, 3.1, 1.2), IV 17.3 (4.3, 1.6, 4.4, 5.2, 1.8). Leg formula 4123. Spination of palp and legs: palp 151, 000, 122; femora I p021, d111, r112, II p112, d111, r112, III p111, d111, r111, IV p012, d111, r112; patellae I-IV 101; tibiae I p010, d101, r110, v22222, II p10, d101, r110, v22222, III-IV p11, d111, r11, v222; metatarsi I p111, d001, r111, v222, II p111, d111, r111, v222, III p111, d012, r111, v222, IV p112, d011, r112, v222. Chelicerae with 3 promarginal, 4 + 2 retromarginal teeth and with elongated patch of 3 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 2 bristles. Sparse scopula restricted almost entirely to tarsi. Leg claws I with 6, II-III with 5 and IV with 4secondary teeth. Position of tarsal organ: I 1.89, II 1.03, III 0.75, IV 1.56.

Palp (Fig. 12 a-c). Palpal tibia without RTA and intrasegmental sclerite, distally with 2 stout retrolateral spines. Cymbium tip slightly conical. Embolus (Fig. 14 b) arising at 12 o’clock position, long and laminar, running around tegulum, its tip situated distally. Conductor absent. Tegular apophysis arising at 12 to 12.30 o’clock position subdistally.

Colour (Fig. 13 c and d). Yellowish-brown with light brown markings. Dorsal prosoma with distinct light median band and dark lateral bands, light patches partly fused, frontally with 2 light patches close to ALE. Sternum, coxae, labium and gnathocoxae pale yellowish without patterns. Chelicerae yellowish-brown with longitudinal dark lines frontally. Palps and legs yellowish-brown, legs I-III with pattern especially from femora to tibiae. Dorsal opisthosoma yellowish-brown with distinct serrated light median band. Lateral opisthosoma spotted. Ventral opisthosoma yellowish, with posteriorly converging lines of spots. Spinnerets light, anterior lateral spinnerets laterally dark, anal tubercle light.

Female (IZCAS-Ar 43539): See Fig. 13 a, b, e and f; figs 1-6 in Jäger and Minn (2015).

Diagnosis

Small Ctenidae (total length male 6.6). The species can be distinguished from all known congeners by the embolus arising at 12 o’clock position, long and laminar, running around tegulum, its tip situated distally (Fig. 12 b and Fig. 14 b), by the palp having no conductor (Fig. 12 a-c), by the tegular apophysis arising at 12 to 12.30 o’clock position subdistally (Fig. 12 b) and by the tibia distally with 2 stout retrolateral spines (Fig. 12 b and c). For the diagnosis of female, see Jäger and Minn (2015).

Distribution

Myanmar (Sagaing Hill, Fig. 1 ; Mt Popa, type locality).

DNA Barcode

Male (IZCAS-Ar 43538):

TATTTGGGGCTTGAGCTGCTATAGCGGGTACTGCAATAAGAGTTTTGATTCGAATGGAATTAGGACATCCTGGAAGATTATTAGGTGATGATCATTTATATAATGTTATTGTAACAGCTCATGCTTTTGTTATGATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGAGCTCCGGATATATCATTTCCTCGAATAAATAATTTATCTTTTTGGTTATTACCTCCTTCTTTGTTTTTATTGTTTATATCTTCTATAGTTGAAATAGGTGTAGGAGCAGGGTGAACAGTTTATCCTCCTTTAGCTTCTAGAATTGGGCATGCAGGGAGATCTATGGATTTTGCTATTTTTTCTTTACATTTAGCGGGTGCTTCTTCTATTATAGGGGCTGTAAATTTTATTTCTACTATTATTAATATACGATTAATAGGAATGACTATAGAGAAGGTTCCTTTGTTTGTTTGATCTGTTTTTATTACTGCAATTTTATTATTGTTATCTTTACCAGTGTTAGCTGGTGCTATTACAATATTATTAACTGATCGTAATTTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAGTTTTATTTCAGCATTTGTTTTGATTTTTTG (GenBank accession number OP572105).

Female (IZCAS-Ar 43539):

TTTTTGGAGCTTGAGCCGCTATAGCGGGTACTGCAATAAGAGTTTTAATTCGAATAGAATTAGGGCATCCTGGGAGATTATTAGGTGATGATCATTTATATAATGTTATTGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATGTTAGGAGCTCCGGATATATCATTTCCTCGAATAAATAATTTATCTTTTTGATTATTACCTCCTTCTTTGTTTTTATTGTTTATATCTTCCATGGTTGAAATAGGTGTGGGAGCAGGATGGACAGTTTATCCTCCTTTAGCTTCTAGAATTGGGCATGCGGGAAGATCTATGGATTTTGCTATTTTTTCTTTACATTTAGCGGGTGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCGACTATTATTAATATACGATTAATAGGAATGACTATAGAGAAGGTTCCCTTATTTGTTTGATCTGTTTTTATTACTGCAATTTTATTGTTATTATCTTTACCAGTATTAGCTGGTGCTATTACGATGTTGTTAACTGATCGTAATTTTAATACTTCTTTTTTTGACCCTGCTGGGGGAGGGGATCCGGTTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572104).

Figures

Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n.

Figure 12. Anahita popa Jaeger & Minn, 2015, palp, male from Sagaing Hill. a: Prolateral view; b: Ventral view; c: Retrolateral view. DS = distal retrolateral spine, E = embolus, TA = tegular apophysis. Scale bar: 0.2 mm (a-c).

Figure 13. Anahita popa Jaeger & Minn, 2015, male and female from Sagaing Hill. a: Female, epigyne, ventral view; b: Same, vulva, dorsal view; c: Male, habitus, dorsal view; d: Same, habitus, ventral view; e: Female, habitus, dorsal view; f: Same, habitus, ventral view. FD = fertilisation duct, LT = lateral teeth, SP = spermathecae, SS = slit sensillum. Scale bars: 0.2 mm (a, b), 1.0 mm (c-f).