Lokruma stenii Tedersoo, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

Lokruma stenii Tedersoo sp. nov.

Diagnosis.

Separation from other species of Lokruma based on the ITS region (positions 159–178 taacttaattttttcccgag; one mismatch allowed) as shown in Fig. 10 . There are no short barcodes in the first 700 bp of LSU that allow distinguishing L. stenii all from other congeners.

Type.

Soil eDNA sample TUE 103193 (holotype); type sequence EUK 1203766 (lectotype); GSMc plot S 689, Pinus halepensis forest (soil sample TUE 003193 ) in Lokrum , Croatia, 42.6223 ° N, 18.1241 ° E .

Description.

Other sequences: EUK 1603283 (GSMc plot G 4301, Betula pendula forest soil in Männamaa, Estonia, 58.83258 ° N, 22.63346 ° E); EUK 1604041 (GSMc plot S 480, Populus - Picea forest soil in Käru, Estonia, 58.80407 ° N, 25.22249 ° E); EUK 1604042 (GSMc plot G 4734, Populus - Alnus forest soil in Urissaare, Estonia, 58.02673 ° N, 24.65739 ° E); and EUK 1600039 (LSU: GSMc plot HB 19, Populus x wettsteinii forest plantation soil, Oja, Estonia, 58.82747 ° N, 26.37799 ° E).

Etymology.

Lokrum (Serbo-Croatian) refers to type locality; and Sten (Estonian) refers to the first name of Sten Anslan who collected the materials from the type locality.

Notes.

Found in Croatia and Estonia, with ITS and LSU sequences displaying up to 1 % of differences.

Figures

Figure 10. Diagnostic barcodes for Lokruma stenii relative to closely-related taxa in ITS 2.