Edaphochytrium Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Edaphochytrium Tedersoo gen. nov.

Type species.

Edaphochytrium valuojaense Tedersoo .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 114–133 in type species and S. cerevisiae cagtctcttaaggagataat; one mismatch allowed). Forms a monophyletic, least inclusive clade in Edaphochytriaceae, covering sequences EUK 1200051 , EUK 1630709 , EUK 1200763 , and EUK 1123748 (Figs 1 , 8 ).

Notes.

Recognized based on eDNA sequences only. Comprises potentially 4–5 species represented by sequences EUK 1200051 (forest soil in Estonia), EUK 1630709 (forest soil in Estonia), and EUK 0133658 (plantation soil in the Canary Islands).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.

Figure 8. Maximum Likelihood SSU- ITS - LSU phylogram indicating the position of Edaphochytrium valuojaense within Edaphochytriomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Chytridiomycota spp. were used as an outgroup.