Polyommatus lurae Parmentier, Vila et Lukhtanov, 2022

Parmentier, Laurian, Vila, Roger & Lukhtanov, Vladimir, 2022, Integrative analysis reveals cryptic speciation linked to habitat differentiation within Albanian populations of the anomalous blues (Lepidoptera, Lycaenidae, Polyommatus Latreille, 1804), Comparative Cytogenetics 16 (4), pp. 211-242 : 211

Polyommatus lurae Parmentier, Vila et Lukhtanov sp. nov

Description.

Typical dark ground colour of both veins and intervein space of dorsal wing sides. A character that appears useful for separation of P. orphicus and P. lurae sp. nov is the brighter yellow-greenish reflection of the former which is generally lacking in the newly described taxon. However, worn individuals of the two taxa may be indistinguishable externally and also from P. ripartii , which is found sympatrically in all locations studied. While Misja (2005) reports P. admetus from the same Lurë region, we never found P. admetus in sympatry with the new taxon in all Lurë locations surveyed. While the latter observation may be based on a wrong identification of the newly described taxon, also lacking white stripes on the hindwing underside, P. admetus is easily separated from P. lurae , especially because of the strongly marked underside in P. admetus , with a double row of small dots in the submarginal zone of underside wings, which has never been observed nor reported in literature in the taxa of the P. aroaniensis species complex, including P. lurae .

Holotype.

(Fig. 8a-c ) Male, field code specimen 18-116-X100, COI barcode number RVcoll22A028 (DNA extraction in RVcoll, Barcelona, Spain), GenBank accession number ON715901. Locus typicus: Albania, Dibër prov., Lurë region, Mountain ridge with ophiolitic soil substrate North of Cidhën near Fushë Lurë, 1250 m., 24.VII.2018, L. Parmentier leg. et coll. Holotype in LPA collection, Zulte, Belgium

Paratypes.

Nine males and one female were studied in depth, with field codes of voucher specimen in LP collection (RVcoll number/ GenBank accession numbers of barcodes): LP18-115-K71 (RVcoll18D271/ ON715896), LP18-115-K73 (RVcoll18D273/ON715897), LP18-116-K68 (RVcoll18D268/ ON715898), LP18-116-K70 (RVcoll18D270/ ON715899), LP18-116-K77 (RVcoll18D277/ ON715900), LP18-116-K81 (RVcoll18D281/ ON715903), LP18-116-X100 (RVcoll22A028/ON715903), LP18-115-X98 (RVcoll22A025/ON715895), all North of Cidhën near Fushë Lurë, 1050-1600m. 23-24.VII.2018; LP18-118-K88 (RVcoll18D288/ ON715904), LP18-119-K79 (RVcoll18D279/ ON715902) Lurë region, Pregj Lurë 24.VII.2018. Additional material: 15 males, 5 females, same localities, collection dates 23- 24.VII.2018. All paratypes have red labels indicating P. lurae sp. nov, name of authors, signature of first author and exact localities.

Karyotype.

The haploid chromosome number P. lurae sp. nov is determined as n=42-43 (Fig. 4 ).

COI barcode sequence of the holotype.

657 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTCTAAGAATTTTAATTCGTATGGAATTAAGAACTCCTGGATCCTTAATTGGAAATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTTCCCTTAATATTAGGAGCACCTGATATAGCCTTTCCCCGATTAAATAATATGAGATTTTGATTATTACCACCATCATTAATACTACTAATTTCTAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCACATAGAGGATCATCTGTAGATTTAGCAATTTTCTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATCATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTGGGAATTACAGCATTATTATTACTTTTATCATTGCCTGTATTAGCTGGAGCAATTACCATATTACTAACAGATCGAAACCTTAATACCTCATTCTTTGACCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT.

Description.

Males. (Fig. 8c, l, m ). Forewing length 15.8-17.9 mm. Upperside: ground colour completely dark chocolate brown. Discoidal, submarginal and antemarginal markings absent on both fore- and hindwings. Veins poorly contrasting. Forewings with a developed sex brand and dark scale tuft. Fringe grayish brown. Underside: ground colour yellow-brown with ochreous to reddish coffee-milk tint. Minimal greenish blue basal suffusion. One basal black spot is present only on hindwings. Discoidal black spot is present on the forewings, but can be slightly seen on the hindwings (absent or vestigial). Postdiscal black ocelli most prominent on forewings; when present encircled by a whitish border. Postdiscal black ocelli on the hindwing small and sometimes lacking. Submarginal and antemarginal mark-ing is absent on the forewings, and absent or vestigial on the hindwings. White streak on hindwings generally absent or very faint. Only rarely, the white streak is vestigial; no single specimen was observed with an additional short streak between postdiscal and submarginal areas of the wing, straight under the main white streak. Fringe brown, slightly darker than the underside ground colour.

Male genitalia. The valva of the male genitalia of P. lurae sp. nov is depicted in Fig. 10 . Male valves have a structure typical for other species of the subge-nus Agrodiaetus ( Coutsis (1986), Coutsis, pers. comm.). According to Kolev (2005) who studied the morphometry of the male genitalia of P. orphicus no overlap with P. ripartii was observed. As male genitalia within the P. aroaniensis species group do not significantly differ from each other, those from P. lurae may follow the same trend, but no additional analyses nor measurements have been performed.

Females. Forewing length 15.8-17.5 mm. Upperside: ground colour as in males, but lighter dark brown and without sex brand and scaletuft. Fringe greyish brown. Underside: ground colour and general design as in males but fringes lighter-coloured. Greenish blue basal suffusion almost invisible. White streak on hindwing underside mostly absent (Fig. 7j, k ). If present, it demonstrates a variable level of reduction.

Life history.

Polyommatus lurae inhabits xerothermic and xeromontane ophiolitic habitats. While in some of the localities the soil can be mixed with a minor degree of a calcareous component, P. lurae was never found at pure calcareous biotopes. Indeed, at such localities only P. orphicus was found, together with P. ripartii , which is in agreement with the original description of these species (Kolev, 2005). The vegetation of the type locality is sparse and dominated by low-growing grasses and flowering plants identified as Artemisia alba Turra and Satureja montana Linnaeus. Besides, other xerophilous species were observed, including scattered Juniperus bushes and low Pinus nigra trees (Fig. 1d ). In all known localities P. lurae is syntopic with P. ripartii , a species widespread in the Balkans, although especially abundant in calcareous habitats (pers. obs. L. Parmentier).

Distribution and biotope.

The three known localities of P. lurae (including the type locality) are situated in the Lurë region, in the vicinity of the National Park (Parku Kombëtar Lurë-Mali i Dejës), North of the village Cidhën, along a North-Southern orientated mountain ridge and gorge at altitudes between 950 and 1.600 m (Fig. 9a ). The habitats are all situated within ophiolitic soil substrates (in some localities these substrates are slightly intermixed with a minor amount of lighter karst substrate), which are not rare in some parts of Albania. In these typical ophiolitic soil substrates the presumed host plants of the genus Onobrychis were observed (Fig. 1e, f ). However, there are as yet no observations regarding the first stages of this taxon and the larval host plant is unconfirmed.

The aforementioned ophiolitic substrates can be found in a discontinuous range from Southern Albania (Provinces Korcë, Qukës) up to the Northern part of the country (provinces Dibër, Kukës). Within Europe these rather rare substrates are present mostly in Albania, while neighbouring countries of North Macedonia and Kosovo contain them to a minor degree. Thus, it is not impossible that the species is also present in other ophiolitic habitats where the presumed host plant is growing. Collection material from another locality in Voskopojë ( Korçë prov.), situated more South, also harbouring typical dark ophiolitic soils was studied. In this locality, a single specimen (RVcoll14B767) genetically attributable to P. lurae was found by Sylvain Cuvelier and Morten Mølgaard, but it is not included in the type series because of the lack of karyological data and morphometrics. Additional specimens from this locality could not be found even after thorough explorations in 2018 and 2022, while only P. ripartii could be confirmed.

Differential diagnosis.

From nominotypical P. orphicus the new taxon is generally distinguished by the strong reduction of a white postdiscal streak on the forewing underside, a darker colour of the upperside and underside wing, lack of wing reflectance, and less contrasting veins on the upperside. Its karyotype is different by at least one fixed chromosome fission (n=41-42) and its COI barcode. From P. aroaniensis , which is the most similar taxon externally, fresh individuals of the new taxon are distinguished by the constant presence of a typical dark ground colour of both veins and intervein space of dorsal wing sides and a generally darker colour of the upperside and underside wing (while in Polyommatus aroaniensis a warm reddish brown colour is typical). However, worn individuals may be indistinguishable externally, while they still can be identified by karyotype (n=48) and by the COI barcode. In the case of P. lurae , its dark habitus is linked to its typical environment with dark ophiolites, while the taxa P. orphicus and P. aroaniensis are generally found in biotopes with paler karst soil substrate. From the sympatric and syntopic P. ripartii , the new taxon is more easily distinguished by the absence of a white postdiscal streak on the forewing underside and, on average, a more reduced appearance of postdiscal spots, and on the upperside the veins are less pronounced and of a similar tone than the paler ground colour. This may be useful for discriminating even slightly worn individuals of the two taxa, while worn individuals are mostly indistinguishable externally. Yet, its karyotype (n=90) and COI barcode are strongly different. P. admetus has not been observed on the same biotopes and thus the new taxon could be separated geographically. Besides, P. admetus has a very distinct appearance by especially its strongly marked underside (with a double row of small dots on the marginal to submarginal zone of the underside hindwings, a trait that is lacking in the aforementioned species.

Etymology.

Derivatio nominis.

The adjective Polyommatus lurae has two meanings: "ascribed to Lurë” and "surviving attacks of congeners". First, the species name is deducted from the Albanian “Lurë region, where the type locality lies, and referring to the old village Lurë e Vjetër situated in central-Eastern Albania ( Dibër province). The name alludes to the fascinating history of the old Lurë village: during the Ottoman war, the village was asked 300 women by the enemies. Armed men, disguised with the duvak, the traditional red bridal veil, were sent instead on horseback to the Ottoman camp. As a result, the Ottomans were taken by surprise and the Lura tribe eventually won the battle. Also, this second meaning seems adequate for the taxon Polyommatus lurae : this species likely experienced periods of close contact with congener species more largely distributed in the Balkans, as is the case at present, but nevertheless has been able to avoid complete admixture and still survives in its unique ophiolitic biotope.

Figures

Figure 1. Biotope and specimens in their natural biotopes at the Lure region a P. lurae sp. nov uns. (sample code 18 - 115 - K 71), Albania, Diber prov., Lure region, 24. VII. 2018 in its biotope b P. lurae sp. nov ups., same specimen c Albanian P. orphicus (sample code 18 - 124 - X 103) in its biotope on Karst substrate, Diber prov., Lure region, 25. VII. 2018, NW of Cidhen village d typical biotope of P. lurae with dark ophiolitic soil substrate e, f Onobrychis alba, host plant for Polyommatus (Agrodiaetus) sp., growing in ophiolitic soil substrate.

Figure 4. Karyotypes of Polyommatus orphicus from Albania a sample K 75, MI, n = 42 b sample K 76, MII, n = 42 c sample K 80, MI, n = 42. Scale bar: 10 μm.

Figure 7. a distribution map based on literature and predictions of the anomalous blues within the P. aroaniensis species complex in the Balkan peninsula; colours correspond to the species in the legend; box is indicating the Lure region in Albania b detailed map of the Lure region with observations of P. lurae sp. nov (black dots) on dark ophiolites, P. orphicus (brown dots) and putative hybrids (blue dots) in the contact zone (blue dots) and a dispersive specimen outside suitable biotope (paler blue dot).

Figure 8. The colouration and wing pattern of P. lurae sp. nov, P. orphicus and P. ripartii. The letters correspond to the following species (and voucher sample codes as listed in Table 1): a-c P. lurae sp. nov HT male (18 - 115 - K 71) d, f P. lurae x P. orphicus putative hybrid (17 - 94 - 3) g, i P. orphicus (18 - 115 - K 76) j, k PT female (18 - 116 - K 77) l, m P. lurae PT (18 - 116 - X 100) n-o P. ripartii (same collecting data as 18 - 115 - K 76). Pictures of c, f, i were taken in natural sunlight but with same position as morphometric analysis (see in M & M section); Notice the differences in reflectance on dorsal wings in the postdiscal zone which is circled and indicated by arrow. Scale bar: 10 mm.

Figure 9. NMDS plot representing the morphometric analysis of dorsal male wings reflectance measurements of P. orphicus (orange dots) and P. lurae sp. nov (black dots). Stress = 0.02; specimens indicated in blue are potential P. lurae x P. orphicus hybrids collected in the contact zone and showed intermediate wing reflectance. Different symbols represent collection sites of three studied habitat with different substrate types (ophiolitic, karst, mixed). Ellipses represent 95 % confidence intervals of specimen groups ' Polyommatus orphicus ', ' Polyommatus lurae ' and ' hybrid'.

Figure 10. Valva of male genitalia of P. lurae sp. nov (G. Coutsis prep. 2018)