Aquamastix sanduskyensis Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Aquamastix sanduskyensis Tedersoo & Esmaeilzadeh-Salestani sp. nov.

Diagnosis.

Separation from other species of Aquamastix based on ITS 2 (positions 112–131 aatattaatatatttattaa; one mismatch allowed) and LSU (positions 471–490 aagacttataattaaaggac; one mismatch allowed) as indicated in Fig. 18 . Intraspecific variation up to 1.2 % in ITS 2. Closest species differ by> 20 % in ITS 2 and> 10 % in LSU.

Type.

Vouchered sediment sample TUE 031498 ( holotype); eDNA sequence EUK 1124847 = OZ 253794 ( legitype); eDNA sample TUE 131498 ( nucleotype); FunAqua sample W 0822 s, Sandusky Bay , Lake Erie, OH, USA, 41.45, –82.96 .

Description.

Other sequences: EUK 0320721 (FunAqua sediment sample W 0987 s, Szczecin Lagoon, Poland, 53.74°N, 14.44°E) and GlobalFungi accession 19 c 3 de 17 f 55 f 5 bab 0644510 c 210733 d 4 (sediment in Hulun Lake, Inner Mongolia, China, 48.86°N, 117.4°E; two biological samples).

Etymology.

Aqua (Latin) and mastix (Greek) refer to water and Neocallimastix, respectively, and Sandusky (Wyandot) refers to the cold waters and the part of Lake Erie where the type material originates.

Notes.

Found in sediments of lakes in the Northern Hemisphere (n = 3 records).

Figures

Figure 18. Diagnostic nucleotide sequences of Aquamastix sanduskyensis relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk). The full GlobalFungi accession for 19 c 3 de 17 f 5 is 19 c 3 de 17 f 55 f 5 bab 0644510 c 210733 d 4.