Chthonolpidiomycetes Tedersoo

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Chthonolpidiomycetes Tedersoo class. nov.

Type order.

Chthonolpidiales Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signature in LSU D 2 (positions 695–714 in type species and 604–623 in S. cerevisiae gactgcttgcaggctgcata; three mismatches allowed). Forms a monophyletic, least inclusive clade in Olpidiomycota, covering sequences EUK 1124876 , EUK 0534818 , EUK 0534797 , EUK 1191212 , and EUK 1138033 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Encoded as clade GS 93 K in EUKARYOME v 1.9. Currently harbors Chthonolpidiales (ord. nov.). Comprises potentially 25–30 species. Detected in soil (95.9 % out of the 73 records) and mosses (4.1 %) in tundra to hot tropical biomes across all continents except Antarctica.

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.