Aquieurochytriales Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Aquieurochytriales Tedersoo & Esmaeilzadeh-Salestani ord. nov.

Type family.

Aquieurochytriaceae Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 1 (positions 171–185 in type species and S. cerevisiae ggcaagccgggcaaa; one mismatch allowed), SSU V 4 (positions 871–885 in S. cerevisiae atactttcattagtc; one mismatch allowed), and ITS 2 (positions 173–195 in type species taatgctgggcgtcagcctgctt OR taatgacgggcgtcagcctgctt; three mismatches allowed). Forms a monophyletic, least inclusive clade in Aquieurochytriomycetes, covering sequences AB 971081, EUK 1100022 , EUK 1102113 , EUK 1123700 , and EUK 1102276 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Currently includes Aquieurochytriaceae (fam. nov.).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.