Leurus billeberhardi Zuñiga & Valerio, 2024

Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2024, Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica, Zootaxa 5529 (3), pp. 511-531 : 515-516

Leurus billeberhardi Zuñiga & Valerio , sp. nov.

( Fig. 7 )

Diagnostic description. Female. Fore wing length, 5.2−5.6 mm (holotype 5.3 mm). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. Coloration. Antennal scape pale yellow to brownish, pedicel yellowish to light brown, flagellum dark brown; tegula light yellow anteriorly, brown posteriorly; metasoma black, with metallic blue iridescence. Trochanters yellowish orange to light brown; fore and mid femora predominantly black, hind femora entirely black; fore and mid tibiae pale yellow to orangish, hind tibiae pale yellow basally, black apically; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark.

Male: Unknown

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0042761 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste , Costa Rica, 11- SRNP-2012. Database information: Costa Rica, ACG, Alajuela Prov., Sector Rincon Rain Forest , Camino Albergue Oscar , 10.87741, -85.32363, 560m (Elda Araya) host Rhectocraspeda periusalis ( Crambidae ) feeding on Piper sancti-felicis ( Piperaceae ) coll. 16.v.2011, wasp eclosed 11.vi.2011. Paratypes. 3 ♀, ( EMUS, MNCR). COSTA RICA, ACG database codes: 12-SRNP-1712: DHJPAR0048887 (♀); 10-SRNP-70339: DHJPAR0039118 (♀); 09- SRNP-56157: DHJPAR0036029 (♀).

Barcode. Holotype DHJPAR0042761 (574 bp)

CGGCCCATTAATTAATAATGACCAAATTTACAATTCTATTGTTACTATACATGCCTTTATTATAATTTTCTTTATA GTTATACCAATTATGATTGGTGGATTTGGTAACTGACTCACCCCTTTAATATTAGGAGCCCCAGATATAGCTTTCC CTCGAATAAATAATATAAGATTTTGATTACTACCCCCTTCCCTATTTTTATTAATTGCAGGAAGAATCCTAAACCA AGGTGCTGGAACTGGTTGAACAGTATACCCCCCACTTTCATCTAACACAAACCATGAAGGATTATCTGTTGACTTA AGAATTTTCTCTCTCCATTTAGCAGGTATATCTTCAATTATAGGTGCAATCAATTTTATTACAACTATTCTAAATA TAAAAATTAAATCATTAAAATTTGAGCAACTTTCTTTATTTATTTGATCAATTAAAATTACTACAATTTTACTTTT ATTAGCAGTACCTGTTTTGGCAGGAGCAATTACCATGCTATTAACTGACCGTAATTTAAATACTTCCTTTTTTGAC CCTAGAGGGGGGGGAGACCCAATTTTATACCAACATTTATTT

Etymology. This species is named in honor of William Eberhard in recognition of his decades of study of the evolutionary biology of insect and spider reproduction, as well as the biology of pimpline ichneumonids parasitizing spiders.

Comments. While the female (male unknown) of E. billeberhardi appears to be morphologically identical to that of E. maryjanewestae at our level of inspection, and both species parasitize the same species of crambid leaf roller feeding on rain forest Piperaceae in the same part of ACG, they are about 9% different in their DNA barcodes ( Fig. 2 ), and therefore we are describing them as new, sibling species. However, this is still a tentative conclusion. Close inspection of the four “barcodes” of L. billeberhardi reveals that all four are the same pseudogene. While it would be logical, from the host data, to conclude that they are pseudogenes of the barcodes of L. maryjanewestae , which appears to be morphologically identical to L. billeberhardi , in fact they appear to be pseudogenes of the barcodes of L. wahli . However, L. wahli is exclusively a parasite of Herpetogramma phaeopteralis (a grass-feeding rain forest crambid that is very different from the Solanaceae-feeding rain forest crambid host of L. billeberhardi ). This story will unfold further with additional samples and exploration.

Hosts. Leurus billeberhardi is a very low density parasitoid, having been reared just four times from 490 wild-caught caterpillars of Rhectocraspeda periusalis (Walker) ( Crambidae ), its sole host species, from among a sample of 65,000+ wild-caught ACG Crambidae caterpillars.

Figures

FIGURE 2. Neighbor-Joining tree based on Kimura 2-parameter distances using 296 COI gene sequences for species of Leurus and their known hosts.

FIGURES5–9.Leurusspp.5.L.marojorietownesae(DHJPAR0037758)mesoscutum,dorsalview.6.L.wahli(DHJPAR0039547) mesoscutum,dorsalview.7.L.billeberhardi.(DHJPAR0039118),legs, dorso-lataeralview.8L.caeruliventris(DHJPAR0009640) mesoscutum, dorsal view. 9. L. pammitchellae (DHJPAR0039539) mesoscutum, dorsal view.