Leurus caeruliventris (Cresson)
publication ID |
https://doi.org/ 10.11646/zootaxa.5529.3.5 |
publication LSID |
lsid:zoobank.org:pub:09787995-E3D5-4FB7-AB9F-AFB46371B02B |
DOI |
https://doi.org/10.5281/zenodo.14034654 |
persistent identifier |
https://treatment.plazi.org/id/572E8790-0F1A-A71F-95FE-54BD168CFDC7 |
treatment provided by |
Plazi |
scientific name |
Leurus caeruliventris (Cresson) |
status |
|
Leurus caeruliventris (Cresson) View in CoL
( Figs. 1 View FIGURE 1 , 8 View FIGURES5–9 , 17 View FIGURES 14–19 , 23 View FIGURES 20–25 )
Exochus caeruliventris Cresson, 1868: 38 . Mexico: Cordoba (designated by Cresson, 1916: 22) (ANSP). Cresson mistakenly referred to the lectotype as a male, when in fact it is a female as indicated by Gauld & Sithole (2002).
Leurus caeruliventris (Cresson) Townes, 1946: 59 View in CoL
Diagnostic description. Female. Fore wing length 5.5–6.4 mm. Malar space 0.6–1.1 × basal mandibular width; antenna with 24–25 flagellomeres, most flagellomeres quadrate or transverse, except for the first two and the last, which are slightly longer than wide. Genitalia: setae on ovipositor sheaths extending basally for a distance equal to or greater than 0.3x the total length; setae more or less sparse throughout sheath width, setae somewhat broad and elongated; lower-anterior extension of quadrate plate short and broad, somewhat square-shaped at tip; setae on ventral edge of quadrate plate thin, normally large. Coloration. Antennal scape predominantly yellow, especially on dorsal surface, pedicel yellowish orange to light brown, flagellum orangish brown basally and becoming darker brown apically; tegula light yellow anteriorly, brown posteriorly; metasoma with metallic blue iridescence. Trochanters black; femora predominantly black; fore tibia pale yellow to orangish, mid and hind tibiae pale yellow basally, black apically; fore tarsus pale yellow with last segment more orangish, mid tarsus pale yellow with last 1–2 segments light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark.
Male. Similar to female in size and color. Antenna with 25–26 flagellomeres. Genitalia: digitus completely lobate at base; volsella medial area deep, volsella tip (in lateral view) clearly rounded throughout; phallus apex slender, phallus constriction short; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat broad, phallus width clearly narrower than apex width; distal third of gonoforceps normally setose, setae somewhat sparse.
Lectotype ( ANSP). Examination based on photo ( Fig. 1 View FIGURE 1 ).
Material. Principal specimen used in diagnostic description: ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014003. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 04-SRNP-24763. Database information: Costa Rica, ACG, Guanacaste Prov., Sector del Oro, Quebrada Raiz, 11.02865, -85.48669, 280m (Lucia Ríos) Pleuroptya Solis 03 caterpillar feeding on Laportea aestuans ( Urticaceae ) coll. 22.ix.2004, wasp eclosed 10.x.2004. Conspecific specimens: 66 (♀), 12 (♂), ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 06-SRNP-41603: DHJPAR0028676 (♀); 06-SRNP-41414: DHJPAR0028670 (♀); 06-SRNP-41410: DHJPAR0028667 (♀); 06- SRNP-2583: DHJPAR0028684 (♀); 06-SRNP-5796: DHJPAR0028663 (♀); 06-SRNP-41409: DHJPAR0028666 (♀); 06-SRNP-41596: DHJPAR0028668 (♀); 10-SRNP-35674: DHJPAR0041381 (♀); 06-SRNP-41632: DHJPAR0028672 (♀); 06-SRNP-41647: DHJPAR0028678 (♀); 06-SRNP-2584: DHJPAR0028679 (♀); 06-SRNP-41640: DHJPAR0028686 (♀); 06-SRNP-41629: DHJPAR0028688 (♀); 06-SRNP-41575: DHJPAR0028693 (♀); 06-SRNP-41620: DHJPAR0028696 (♀); 09-SRNP-6572: DHJPAR0038448 (♀); 10-SRNP-6862: DHJPAR0041534 (♀); 06-SRNP-23264: DHJPAR0021589 (♀); 06-SRNP-40802: DHJPAR0009646 (♀); 06-SRNP-40787: DHJPAR0009642 (♀); 06-SRNP-40800: DHJPAR0009640 (♀); 04-SRNP-26313: DHJPAR0013998 (♀); 04- SRNP-24119: DHJPAR0014001 (♀); 04-SRNP-24763: DHJPAR0014003 (♀); 04-SRNP-24770: DHJPAR0014006 (♀); 04-SRNP-26315: DHJPAR0014007 (♀); 06-SRNP-41419: DHJPAR0010099 (♀); 04-SRNP-24961: DHJPAR0009652 (♀); 09-SRNP-40496: DHJPAR0035194 (♀); 10-SRNP-40046: DHJPAR0037837 (♀); 09- SRNP-5602: DHJPAR0037693 (♀); 10-SRNP-2222: DHJPAR0039366 (♀); 10-SRNP-7441: DHJPAR0041071 (♀); 05-SRNP-24015: DHJPAR0028657 (♀); 05-SRNP-23991: DHJPAR0028660 (♀); 06-SRNP-41574: DHJPAR0028682 (♀); 06-SRNP-41644: DHJPAR0028685 (♀); 05-SRNP-23961: DHJPAR0028659 (♀) 05- SRNP-5803: DHJPAR0028658 (♀); 05-SRNP-23450: DHJPAR0028651 (♀); 06-SRNP-41573: DHJPAR0028694 (♀); 06-SRNP-41609: DHJPAR0028692 (♀); 05-SRNP-23958: DHJPAR0028656 (♀); 06-SRNP-41621: DHJPAR0028687 (♀); 06-SRNP-41593: DHJPAR0028695 (♂) 06-SRNP-41407: DHJPAR0028675 (♀); 05- SRNP-6858: DHJPAR0028665 (♀); 06-SRNP-41411: DHJPAR0028674 (♀); 10-SRNP-35675: DHJPAR0041384 (♀); 06-SRNP-41467: DHJPAR0028671 (♀); 06-SRNP-41597: DHJPAR0028691 (♀); 06-SRNP-41598: DHJPAR0028673 (♀); 06-SRNP-41605: DHJPAR0028689 (♀); 06-SRNP-2214: DHJPAR0028680 (♂); 00-SRNP-559: DHJPAR0014008 (♀); 02-SRNP-1204: DHJPAR0014009 (♀); 02-SRNP-1200: DHJPAR0014025 (♀); 02- SRNP-91: DHJPAR0014021 (♀); 06-SRNP-40768: DHJPAR0009641 (♀); 06-SRNP-40666: DHJPAR0009624 (♀); 04-SRNP-24786: DHJPAR0013999 (♂); 04-SRNP-25396: DHJPAR0014000 (♂); 04-SRNP-24766: DHJPAR0014004 (♂); 04-SRNP-24779: DHJPAR0014005 (♂); 02-SRNP-92: DHJPAR0028065 (♀); 10-SRNP-40005: DHJPAR0037822 (♂); 06-SRNP-41648: DHJPAR0028683 (♀); 06-SRNP-41574: DHJPAR0028682 (♂); 05-SRNP-23958: DHJPAR0028656 (♂); 05-SRNP-23991: DHJPAR0028660 (♂); 06-SRNP-40787: DHJPAR0009642 (♀); 04-SRNP-26506: DHJPAR0014002 (♀); 12-SRNP-41403:DHJPAR0048896 (♀); 12-SRNP-31262: DHJPAR0054414 (♀); 13-SRNP-1430: DHJPAR0052160 (♀); 13-SRNP-1429: DHJPAR0052146 (♀); 13- SRNP-350: DHJPAR0050742 (♀); 12-SRNP-1172: DHJPAR0048802 (♀); 13-SRNP-343: DHJPAR0051714 (♀); 13-SRNP-348: DHJPAR0050738 (♂); 13-SRNP-344: DHJPAR0050741 (♂).
Barcode. DNA barcode of female holotype DHJPAR0014003 (660 bp):
GGTGCTTCTTTAAGAATTATTATTCGAATAGAACTTGGTACCCCTGGATCTCTAATTAATAATGACC AAATTTATAATTCCATTGTAACTATACATGCCTTCATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGG ATTTGGAAATTGACTCACTCCTTTAATGTTAGGGGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTG ATTATTACCTCCATCATTATTTTTATTAATTTCTGGAAGAGTTTTAAATCAAGGAGCTGGAACTGGTTGAAC AGTTTACCCTCCTTTATCATCTAATACAAATCATGAAGGTTTATCAGTTGATTTAAGAATTTTTTCTCTCCATTT AGCTGGAATATCCTCAATTATAGGTGCAATTAACTTTATTACAACTATTTTTAATATAAAAATTAAATTTTAA CTTTAGATCAACTTTCTTTATTTATTTGATCTATTAAAATTACCACTATTTTACTTTTATTAGCAGTTCCTGTTTT AGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGACCCAAGAGGAGGAGGAGAC CCTATTTTATACCAACACTTATTT
Etymology. This species is presumably called L. caeruliventris because of the bluish reflections on the metasoma.
Comments. Leurus caeruliventris sensu stricto can be recognized by the following combination of characteristics: metasoma with at least some metallic blue reflections; tegula light colored anteriorly, dark posteriorly; dorsal surface of scape mostly yellowish. The antennal flagellum of females tends to be quite orangish, especially in the basal half, while most other species treated here have a dark brown flagellum.
Leurus caeruliventris was described by Cresson in 1868 from a female collected at Cordoba, Veracruz, Mexico. Cordoba, at an intermediate elevation on Caribbean-facing slopes, has a climate and ecosystem almost identical to that of all of the species of Leurus newly described in this paper, except at a somewhat higher latitude. The lectotype was designated by Cresson (1916) and this specimen (deposited at ANSP; Fig. 1 View FIGURE 1 ) is morphologically identical to what we have designated as Leurus caeruliventris . This species was previously referred to as Leurus caeruliventris DHJ 07 for a working species-level interim epithet. Townes & Townes (1959: 149) described a new subspecies, L. caeruliventris borealis , from Maryland in the U.S.A. (USNM, not examined), which was synonymized with L. caeruliventris caeruliventris (Cresson) by Gauld & Sithole (2002). Given the number of cryptic species that have been revealed by the present investigation of just ACG material, it is likely that Leurus caeruliventris borealis is a species distinct from L. caeruliventris caeruliventris . A re-examination of North American, as well as Mexican, “ L. caeruliventris ” is required to resolve this question.
Hosts. Leurus caeruliventris has been reared from two Patania (= Pleuroptya ) Solis04 ( Crambidae ) caterpillars feeding on rain forest Cecropia ( Urticaceae ) and from 88 caterpillars of Patania Solis 03 feeding on various species of Urticaceae ( Table 1 View TABLE 1 ), from a sample of 4,400+ wild-caught Patania caterpillars feeding on Urticaceae . These two host caterpillars are also utilized by L. iangauldi . However, L. caeruliventris has also been reared from Pantographa expansalis (Lederer) ( Crambidae ), which also feeds on Urticaceae and has not yet been recorded as a host for any other ACG Leurus species.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |
Leurus caeruliventris (Cresson)
Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H. 2024 |
Leurus caeruliventris (Cresson)
Townes, H. 1946: 59 |
Exochus caeruliventris
Cresson, E. T. 1916: 22 |
Cresson, E. T. 1868: 38 |