Langduoa dianae Tedersoo, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

Langduoa dianae Tedersoo sp. nov.

Diagnosis.

Separation from other species of Langduoa based on the ITS region (positions 87–106 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and LSU (positions 617–636 ccctctcggggggctgggga; no mismatch allowed) as indicated in Fig. 8 .

Type.

Soil eDNA sample TUE 128827 (holotype); eDNA sequence: EUK 1107335 (lectotype); montane grassland in Langduo , Tibet, 29.4 ° N, 94.4 ° E .

Description.

Other sequences: EUK 1602727 and EUK 1602728 (both from GSMc plot G 5906, stadium grassland soil in Karksi-Nuia, Estonia, 58.10088 ° N, 25.55959 ° E); EUK 1604031 (GSMc plot G 4185, Picea - Pinus forest soil in Ristipalo, Estonia, 58.10241 ° N, 27.47874 ° E); and EUK 1604032 (GSMc plot G 4766, soil of coppiced garden dominated by Fraxinus and Ulmus in Ruudiküla, Estonia, 58.33630 ° N, 25.78084 ° E).

Etymology.

Langduo (Tibetan) refers to type locality; and Diana (Lithuanian) refers to the first name of Diana Marčiulynienė who was the first to record this genus.

Notes.

Found from grassland soils in Estonia and Tibet, with ITS and LSU sequences differing up to 0.2 %. So far, not found from the roots.

Figures

Figure 8. Diagnostic barcodes for Langduoa dianae relative to closely-related taxa in ITS 2 and LSU.