Gorgopas trocha Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16645364 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4BF7-7281-FD91-FCF4AA98FA81 |
|
treatment provided by |
Felipe |
|
scientific name |
Gorgopas trocha Grishin |
| status |
new species |
Gorgopas trocha Grishin , new species
http://zoobank.org/ 69AF3910-A35A-474E-A0A1-1881F9DBB43F
( Figs. 94 View Fig part, 97–98)
Definition and diagnosis. In addition to the new species described above, specimens from Colombia are genetically differentiated from Gorgopas trochilus (Hopffer, 1874) (type locality in Bolivia, holotype sequenced as NVG-15032D07) at the species level ( Fig. 94 View Fig ); e.g., their Fst /COI barcode differences are 0.45/1.5% (10 bp), and, therefore, represent a new species. This new species keys to G. trochilus (E.28.1) in Evans (1953) but differs from it and the new species described above by being paler, with a more strongly defined contrast between darker brown and paler brown areas giving the dorsal hindwing a checkered appearance, somewhat weaker green overscaling, broader wings, more trapezoidal hindwings, broader valvae and even stronger defined sclerotized inner lobe of harpe. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1139.17.3:A54G, aly1139.17.3:G60A, aly1042.31.2:C89T, aly1042.31.2:A102T, aly96.3.7:T51C; and COI barcode: T46C, 220C, C340C, T400C, T415A, C536T.
Barcode sequence of the holotype. Sample NVG-23055H03, GenBank PV550042, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACCTCTTTAAGTATTCTTATTCGATCAGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTCTTTCAGCTAATATTGC TCATCAAGGTTCTTCAGTAGATTTAACTATTTTTTCCCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAAATTATCA TTTGATCAAATATCCTTATTTATTTGAGCTGTAGGAATTACTGCATTACTTTTATTATTATCTTTACCAGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATCTTAATACAT CTTTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 97 View Fig (genitalia in Fig. 98 View Fig ), bears the following six printed rectangular labels, five white: [ COLOMBIA: TOLIMA | La Marina area , Rio | Ambeima, 1600-1700 m. | 7.vi.1974 | S. & L. Steinhauser], [A. C. Allyn | Acc. 1974-23], [DNA sample ID: | NVG-23055H03 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-24065B04 | c/o Nick V. Grishin ], [genitalia: | NVG241111-16 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Gorgopas | trocha Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1♂ NVG-23055H02 the same data as the holotype but collected on 12-Jun-1974.
Type locality. Colombia: Tolima, La Marina area , Rio Ambeima , elevation 1600–1700 m.
Etymology. The name is formed from the name of its relative, G. trochilus , made shorter to indicate the more northern distribution locality of this species, and is treated as a noun in apposition.
Distribution. Currently known only from Tolima in Colombia.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Pyrginae |
|
Tribe |
Carcharodini |
|
Genus |
