Anisochoria bacchoides Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 156-158

Anisochoria bacchoides Grishin , new species

http://zoobank.org/ C3887697-B08C-4BD4-9A8B-B2E76F59D016

( Figs. 119 part, 120–121)

Definition and diagnosis. Genomic sequencing of several specimens from El Salvador and Chiapas, Mexico, reveals that they are genetically differentiated from Anisochoria bacchus Evans, 1953 ( type locality Mexico: Veracruz, Atoyac) at the species level ( Fig. 119 ); e.g., their COI barcodes differ from A. bacchus by 2.9% (19 bp). Therefore, these specimens represent a new species. This new species keys to “ Anisochoria pedaliodina bacchus ” (E.59.1.(a)) in Evans (1953) and was included within this taxon. However, it differs from its sister species A. bacchus by the following combination of characters: three subapical forewing spots are in a straighter line nearly at a right angle with the costa, the line drawn through them from the costal spot is directed towards the tornus rather than towards the spot in cell M 3 - CuA 1; spots in cell M 3 -CuA 1 and the lower spot in the discal cell are farther apart from each other than in A. bacchus ; spots in the discal cell are usually smaller in size; and the process of the ampulla is longer compared to the harpe. Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly85.36.7: A81G, aly528.11.7:C43T, aly3512.6.1:T144C, aly3512.6.1:A165T, aly3512.6.1:G214A; and COI barcode: T50C, T112C, A160G, 274C, T463C, T539C.

Barcode sequence of the holotype. Sample NVG-23054D06, GenBank PV550053, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCACTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATCTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTGGTACCTTTAATGTTAGGGGCACCCGATATAGCTTTTCCTCGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCTTTAACATTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCCCTTTCATCTAATATCGC TCATCAAGGATCTTCTGTAGATTTAGCTATTTTCTCCCTTCACTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTCATTACTACAATTATTAACATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTCTGAGCTGTAGGAATTACTGCTATTCTTTTACTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAACACAT CTTTTTTTGACCCTGCTGGAGGTGGGGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 120 , bears the following five printed (text in italics handwritten) rectangular labels, four white: [ La Libertad , El Sal. | 10m. | 15-XII-72 | No. H-6039 | Leg S.&L.Steinhauser], [ ANISOCHORIA PEDALIODINA | BACCHUS Ev. ♂ | Det: S.R.Steinhauser], [A. C. Allyn | Acc. 1973-23], [DNA sample ID: | NVG-23054D06 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Anisochoria | bacchoides Grishin]. Paratypes: 2♂♂ and 3♀♀: 1♂ NVG-20062H03 (leg DNA extraction, sequenced), NVG-24015E07 (abdomen DNA extraction and dissection) Mexico, Chiapas, Tuzantán, Rio Huixtla 7 mi N of Huixtla, 7-Aug-1988, J. Kemner leg., genitalia vial NVG241114-13 ( Fig. 121 ) [ TMMC]; Guatemala, Santa Rosa , Guazacapán, ex coll. E. Le Moult [ MGCL]: 1♂ NVG-23054D04 5-Apr-1922 and 1♀ NVG-23054D05 1-Mar-1923; and El Salvador: 1♀ NVG-19091G08 Santa Tecla, 19-Dec-1953, Mauricio Salazar leg. [ USNM] and 1♀ NVG-23054D07 Rio El Molino , nr. Ahuachapán, S. and L. Steinhauser leg. [ MGCL] .

Type locality. El Salvador: La Libertad , elevation 10 m.

Etymology. The name is formed from the name of its sister species, A. bacchus , made longer for this more southern relative. The name is treated as a feminine noun in apposition.

Distribution. Currently known from southern Chiapas ( Mexico), Guatemala, and El Salvador.

Figures

Fig. 119. Phylogenetic trees of selected Anisochoria species constructed from protein-coding regions in: a) the nuclear genome (autosomes), based on 1,278,153 positions, and b) the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. Different species are colored differently: A. bacchus (blue), A. bacchoides sp. n. (red), A. polysticta Mabille, 1877 (green), and A. pedaliodina (A. Butler, 1870) (purple).

Fig. 120. Anisochoria bacchoides sp. n. holotype ♂ NVG-23054D06 in dorsal (left) and ventral (right) views, data in text.

Fig. 121. Male genitalia of Anisochoria bacchoides sp. n. paratype NVG-20062H03 in a) left lateral, b) dorsal, and c) right posterolateral views.