Damas honduras Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 189-190

Damas honduras Grishin , new species

http://zoobank.org/ 3E984A36-0510-48F1-BEE1-4FB2E09D34F4 ( Figs. 148c , 149h–i , 152 part, 153 part)

Definition and diagnosis. Specimens from the northern part of the range of the Damas clavus ( Herrich-Schäffer, 1869) ( type locality in Southeast or South Brazil) complex form a clade sister to Damas angulis ( Plötz, 1886) stat. rest. ( type locality in Panama: Panama) genetically differentiated from it at the species level ( Fig. 152 green vs. purple); e.g., their COI barcodes differ by 2.0% (13 bp), and, therefore, represent a new species. This new species keys to Damas clavus (K.26) in Evans (1955) and differs from all its congeners by the combination of the following characters in males: a larger elongated hyaline spot along the lower side of the discal cell on the forewing, a crescent-shaped (broader than in a typical D. angulis ) hyaline spot in the forewing cell CuA 1 -CuA 2, a rectangular (longer than a typical square-shaped spot of D. angulis ) hyaline spot near the base of forewing cell M 3 -CuA 1, a dot-shaped hyaline spot in forewing cell R 5 -M 1, a diffuse spot of pale scales near the middle of forewing cell CuA 2 -1A+2A near the 1A+2A vein, this spot is much more prominent on the ventral side, otherwise mostly dark brown; the lower portion of the stigma is nearly square, stronger offset distad from the upper portion, which is elongated rather than triangular; the posteriad-directed process of the tegumen is narrower, the uncus is deeper divided, the harpe is more robust with a broader tooth at the base of its dorsal margin. Due to the cryptic nature of this species and poorly explored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1838.42.1:G96A, aly1838. 42.1:G123A, aly85.33.2:C349T, aly85.33.2:A606G, aly706.2.3:G102A. This species may not differ from D. angulis in the COI barcode, possibly due to introgression (e.g., specimen NVG-23123B02 in Fig. 152b ).

Barcode sequence of the holotype. Sample NVG-18093E04, GenBank PV550070, 658 base pairs: AACTTTATATTTTATTTTCGGTGTCTGAGCAGGATTACTAGGAACTTCCTTAAGTATACTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTGCCTTTAATATTAGGTGCCCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTCTACCCCCCCCTTTCATCCAATATTGC TCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATCAATTTTATTACCACAATTATTAATATACGAGTAAGAAATTTATCC TTTGATCAAATACCATTATTTATTTGATCCGTAGGAATTACAGCTCTTTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGATCCAGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Senckenberg Natural History Museum, Frankfurt, Germany ( SMF), illustrated in Fig. 148c , bears the following five printed (text in italics handwritten) rectangular labels (1 st grayish-green, 2 nd and last red, others white): [ Honduras | San Pedro Sula | ex coll. Fruhstorfer], [Para lec- | to typus], [Paralectotypus | Perichares | tripuncta | Draudt, 1923 | O Mielke det 19 79], [DNA sample ID: | NVG-18093E04 | c/o Nick V. Grishin ], and [HOLOTYPE ♂ | Damas honduras | Grishin ]. The holotype is also a paralectotype of Perichares tripuncta Draudt, 1923 (type locality in Panama: Chiriquí as deduced by the genomic sequencing of the lectotype NVG-18093C07, not S. Brazil). Images of this specimen photographed by E. Brockmann are shown on the Butterflies of America website ( Warren et al. 2024). Paratypes: 9♂♂ and 4♀♀: Mexico, T. Escalante leg. [ MGCL]: 1♂ NVG-24099D02 Chiapas, Santa Rosa Comitán , Sep-1965; 2♂♂ Oaxaca, Chimalapa : NVG-24099D 01 Sep-1963 and NVG-24099C 11 Sep-1965; and 1♂ NVG-24099C12 Veracruz, Catemaco , Sep-1956; Guatemala: Petén, Tikal : 1♂ NVG-22057A08 and 1♀ NVG-22057A05 7-Jan-1990, C. J. Durden leg. [ TMMC] and 1♂ NVG-24099C02, UF FLMNH MGCL 104891 11-Sep-1993, D. L. Lindsley leg. [MGCL] and Cayuga, old, Schaus & Barns collection [ USNM]: 1♂ NVG-23123A10, genitalia NVG240817 -69 ( Fig. 149h, i ) and 1♀ NVG-23123A11; 1♀ NVG-24099C01 Belize, Orange Walk District, Gallon Jug , Jan-2006, J. Benner collection [ MGCL]; Honduras San Pedro Sula , old [ MFNB]: 1♂ NVG-24029E03 Coll. Thieme and 1♀ NVG-23075H02 ; and 1♂ NVG-18056H08 " South America " [likely Guatemala], old [ ZSMC] .

Type locality. Honduras: San Pedro Sula .

Etymology. The name rhymes with the genus name and is given for the country with the type locality. The name is treated as a noun in apposition.

Distribution. From southern Mexico to Honduras.

Comment. Note that the genitalia of Damas are sclerotized more weakly than most other Hesperiidae and thus appear paler ( Fig. 149 ).

Figures

Fig. 148. Primary type specimens of Damas in dorsal (left) and ventral (right) views, data in text: a) lectotype of D. corope stat. rest., b) neotype of D. angulis stat. rest., c) holotype of D. honduras sp. n., and d) holotype of D. kenos sp. n. Insets show magnified (scale indicated by 0.5 cm bar) middle of forewing with digitally enhanced stigma of each specimen.

Fig. 149. Male genitalia of Damas, data in text: a–d) lectotype of D. corope stat. rest., left valva detached, aedeagus not shown; e–g) specimen of D. angulis stat. rest. NVG-23123B02, left valva detached; h–i) paratype of D. honduras sp. n. NVG- 23123A10; j–k) paratype of D. kenos sp. n. NVG-23123B06; and l–m) paratype of D. lavandas sp. n. NVG-24099C06. Views: b, e, h, j, m) left lateral, a, d, g) right lateral, c, f, i, k, l) dorsal, d) shows caudal part of the left valva.

Fig. 152. Phylogenetic trees of Damas inferred from protein-coding regions in: a) the nuclear genome (autosomes), b) the mitochondrial genome. Different taxa are shown in different colors: D. honduras sp. n. (green), D. angulis stat. rest. (purple), D. kenos sp. n. (orange), D. cervus stat. rest. (olive), D. corope stat. rest. (blue), D. lavandas sp. n. (red), and D. clavus (cyan). Primary type specimens are labeled in magenta.