Erebia ( Erebia ) pawloskii bilibinia Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 9-10

Erebia ( Erebia) pawloskii bilibinia Grishin , new subspecies

http://zoobank.org/ 79EA8344-F03A-4D4C-A7D4-F3095814D506

( Figs. 3 part, 4)

Definition and diagnosis. Genomic analysis of Erebia ( Erebia) pawloskii Ménétriés, 1859 ( type locality in Russia: Sakha) specimens reveals a clade of a pair from Chukotka, Russia, not monophyletic with any represents a new subspecies. It differs by smaller orange and cream spots than in most other subspecies (except the two mentioned next), the spots are vestigial in the posterior 2/3 rd of the hindwing of a male, but larger ventral hindwing cream spots than in Erebia pawloskii alaskensis W. Holland, 1900 ( type locality in USA: Alaska) and Erebia pawloskii canadensis B. Warren, 1931 ( type locality in Canada: Manitoba). Due to unexplored individual variation in this subspecies, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: hm2021401- RA.2:C36T, hm2021401-RA.2:T87C, hm2004829-RA.3:C54T, hm2007306-RA.8:A114G, hm2018041- RA.1:A456G. However, this taxon does not differ from other subspecies and even related species in the COI barcode because the mitochondrial genome seems to introgress among the relatives ( Fig. 3b ).

Barcode sequence of the holotype. Sample NVG-24041B06, GenBank PV549978, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGTACATCTCTCAGTTTAATTATTCGAACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGTAATTGACTTATTCCTATTATATTAGGAGCCCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGACTCCTTCCCCCCTCTTTAATTTTATTAATTTCAAGTAGTATTGTAGAAAATGGTGCTGGTACAGGATGAACGGTTTATCCCCCCCTTTCATCTAATATTGC TCACAGTGGATCTTCTGTTGATTTAGCAATTTTCTCTTTACATTTAGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGTATATCT TATGATCAAATACCATTATTTGTTTGAGCTGTTGGAATTACAGCATTATTATTATTACTCTCTCTACCTGTATTAGCTGGAGCTATTACAATACTTCTTACAGATCGAAATTTAAACACCT CTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the Staatliches Museum für Naturkunde, Stuttgart, Germany ( SMNS), illustrated in Fig. 4a , bears the following four printed rectangular labels, three white: [ Russland, E.-Sibiria | Chukotka, Bilibino | VII. 1993 | leg. Karpov], [ex coll. W. Eckweiler | SMNS-Lep. 2005 – 07], [DNA sample ID: | NVG-24041B06 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Erebia pawloskii | bilibinia Grishin ]. Paratype: 1♀ NVG-24041B07 the same data as the holotype ( Fig. 4b ) .

Type locality. Russia: Chukotka, Bilibino .

Etymology. The name is given for the type locality and is treated as a feminine noun in apposition.

Distribution. Currently known only from Chukotka in Russia.

Figures

Fig. 3. Phylogenetic trees of selected Erebia (Erebia) species constructed from protein-coding regions in: a) the nuclear genome (autosomes), based on 415,959 positions, and b) the mitochondrial genome. Different species and subspecies are colored differently: E. theano (brown), E. stubbendorfii (olive), E. pawloskii sajana stat. rest. (purple), E. pawloskii pawloskii (blue), E. pawloskii bilibinia (magenta), E. pawloskii alaskensis (green), E. pawloskii canadensis (dark blue), E. pawloskii ethela W. H. Edwards, 1891 (cyan), and E. demmia stat. nov. (red). Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. Gaps in terminal branches indicate that a segment of a tree was cut out to reduce its horizontal dimension (to allow an increase in the font size), i.e., a branch with a gap is longer than shown.

Fig. 4. Erebia (Erebia) pawloskii bilibinia ssp. n. in dorsal (left) and ventral (right) views, data in text: a) holotype ♂ NVG-24041B06 and b) paratype ♀ NVG-24041B07.