Entheus peruveus Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16806842 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B4E-723A-FE66-FCF5AA7AF9F9 |
|
treatment provided by |
Felipe |
|
scientific name |
Entheus peruveus Grishin |
| status |
new species |
Entheus peruveus Grishin , new species
http://zoobank.org/ 8C6657DF-7D8B-4BF8-B177-F17E64A7C11F ( Figs. 31 View Fig part, 36h–k, 40, 50 part, 51j–k)
Definition and diagnosis. Genomic analysis reveals a clade of specimens from Peru that is sister to Entheus latebrosus Austin, 1997 (type locality in Ecuador, holotype sequenced as NVG-15021E04) in the nuclear genome tree but is in a different clade from E. latebrosus in the mitochondrial genome tree, suggesting that it represents a new species due to its inconsistent phylogenetic position and genetic differentiation ( Figs. 31 View Fig , 50 View Fig ), e.g., its COI barcodes differ from E. latebrosus by 2.0% (13 bp). This new species keys to “ Entheus priassus telemus ” (B.10.4(b)) in Evans (1952) but differs from its relatives by a combination of the following characters: in males, forewing bands are bright-orange, the discal band without hyaline areas, the spot between the bands with only a hint of hyalinity distally, and the anterior four spots of the subapical band are semi-hyaline, the posterior two spots mostly opaque and are moderately (by a third to a half of the spot width) offset distad from the anterior three spots; the subapical band is not connected to the discal band; the hindwing is uniformly dark brown on both sides, the hindtibial tuft is tawny; in a female, hyaline and white spots are larger than in E. latebrosus , forewing subapical spots form a continuous band, with the two posterior spots offset distad, discal spots broader, the spot in cell M 3 -CuA 1 is slightly closer to the spot in the cell CuA 1 -CuA 2 than in the cell M 2 -M 3, the dorsal hindwing white area is rectangular, reaching the inner margin, and the brown marginal area is narrower than the white area. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly3839.2.5:C114T, aly3839.2.5:C144T, aly3712.5.7:G120T, aly113.12.1: C94T, aly113.12.1:G111A; and COI barcode: T115C, A133G, A433G, T526C, T610C.
Barcode sequence of the holotype. Sample NVG-14062B08, GenBank PV549996, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTACAATACT ATTGTTACTGCGCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGGGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACCGCATTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTCTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Figs. 40a View Fig and 51k View Fig (genitalia Fig. 36h–k View Fig ), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PERU Madre De Dios | Rio La Torre 300m | Tambopata Res. | 31 OCT.’84 | S. S. Nicolay], [DNA sample ID: | NVG-14062B08 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119E01 | c/o Nick V. Grishin ], [genitalia: | NVG240817-40 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Entheus | peruveus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 3♂♂ and 1♀ from Peru, Madre de Dios: 1♂ NVG-23116H05 data as the holotype but 6-Oct-1986, D. H. Ahrenholz leg.; 1♂ NVG-23064B06 near the type locality, given as Rio Tambopata, 60 km S Puerto Maldonado, Rio Tambopata , 60 km S Puerto Maldonado, D. & J. Lindsley leg. [ MGCL]; 1♂ NVG-23116H04 30 km SW Pto. Maldonado, 300 m, 20- Oct-1983, S. S. Nicolay leg. [ USNM]; and 1♀ NVG-14062B03 Manu National Park, Pakitza , −12.1167, −70.9667, 16-Sep-1989, D. J. Harvey leg. [ USNM] ( Figs.40b View Fig , 51j View Fig ) GoogleMaps .
Type locality. Peru: Madre de Dios Region, Tambopata National Reserve, Rio La Torre , elevation 300 m.
Etymology. The name is formed from the name of the country with the type locality and is treated as a masculine noun in apposition.
Distribution. Currently known from southeastern Peru.
| USNM |
Smithsonian Institution, National Museum of Natural History |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Entheini |
|
Genus |
