Entheus bogoteus Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 60-61

Entheus bogoteus Grishin , new species

http://zoobank.org/ CA6E6079-3FF2-4347-85D2-AC646FD0EB9F ( Figs. 44 part, 49, 50 part, 51r)

Definition and diagnosis. A male from Bogota, Colombia, identified as Entheus latifascius M. Hering, 1925 , stat. rest. ( type locality Colombia, Chocó, Rio Micay) is phylogenetically distant and not monophyletic with it, and instead is sister to Entheus warreni Grishin, 2012 ( type locality in Ecuador: Esmeraldas), being genetically differentiated from it at the species level ( Figs. 44 , 50 ); e.g., their COI barcodes differ by 3.0% (20 bp), thus representing a new species. This new species keys to “ Entheus matho latifascius ” (B.10.5(b)) in Evans (1952), males of which he misidentified and incorrectly associated with females, and differs from its relatives by a combination of the following characters: forewing discal band is orange, partly hyaline towards its outer margin, where it is yellower, lacking an orange streak between the costa and the discal cell reaching towards the wing base, but thicker towards the costa, and the two posterior semi-hyaline spots of the subapical band are strongly (by more than half of their width) offset distad from the rest; the anal fold is creamy-white, slightly yellower towards its sides; the hindtibial tuft is tawny. Due to unexplored individual variation in this species and the lack of known females, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly2012.50.2:C133A, aly2012.50.2:C153T, aly5719.4.12:C177G, aly144.43.21:C132A, aly144.43.21:C141G, aly304.5.1:A60A (not G), aly275211.5.10:T849T (not C), aly5294.1.1:T840T (not C), aly923.16.7:C468C (not T); and COI barcode: A61G, A91G, T284C, A312G, T376C, T427T.

Barcode sequence of the holotype. Sample NVG-22042E08, GenBank PV550003, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGATTATTGATTCGAACTGAATTAGGAACTCCAGGATCGTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGATATAGCTTTTCCTCGGA TAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACACTATTAATTTCTAGAAGAATTGTTGAAAGTGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCTGCTAATATTGC CCATCAAGGATCCTCAGTAGATTTAGCTATTTTTTCCCTTCACTTAGCTGGTATTTCATCAATCTTAGGGGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACCGCATTACTTTTATTATTATCATTACCTGTATTAGCTGGTGCTATTACTATACTTTTAACAGATCGAAACTTAAATACAT CATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTCTCTATCAACATTTATTT

Type material. Holotype: ♂ deposited in the collection of the Academy of Natural Sciences of Drexel University, Philadelphia, PA, USA ( ANSP), illustrated in Figs. 49 and 51r , bears the following four printed (text in italics handwritten) rectangular labels, three white: [ BOGOTA | COLOMBIA], [U. S. N. M. | DIUS MAB. |?], [DNA sample ID: | NVG-22042E08 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Entheus | bogoteus Grishin] .

Type locality. Colombia: Bogotá.

Etymology. The name is formed from the type locality and is treated as a noun in apposition.

Distribution. Currently known only from the holotype collected in Bogotá, Colombia.

Figures

Fig. 44. Phylogenetic trees of Entheus matho group species inferred from protein-coding regions in: a) the nuclear genome (autosomes), based on 1,354,638 positions, b) the Z chromosome, based on 243,684 positions, and c) the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. Primary and secondary type specimens are labeled in red and blue, respectively. Branches of new taxa are shown in red and those with subspecies-to-species status change in blue.

Fig. 50. Phylogenetic trees of Entheus inferred from protein-coding regions in: a) the nuclear genome (autosomes), based on 3,486,282 positions, b) the Z chromosome, based on 279,462 positions, and c) the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. Different species groups and subgroups are colored: eumelus group (olive), gentius group (blue), priassus group (cyan, with telemus and pralina subgroups in purple and red, respectively), warreni group (magenta), and matho group (green). New taxa proposed in this work are labeled in red, and those with taxonomic changes, such as subspecies-to-species or synonym-to-species status (changes indicated in brackets), are labeled in blue.

Fig. 49. Entheus bogoteus sp. n. holotype ♂ NVG-22042E08 in dorsal (left) and ventral (right) views, data in text. The inset shows the hindtibial tuft enlarged two times compared to the specimen (scale not given).

Fig. 51. Entheus specimens already illustrated above (data in text) shown life-size if printed on 8.5 by 11-inch paper for size comparison in dorsal (above each panel letter) and ventral (below) views: a) E. zeus sp. n. HT; b, c) E. priassus: b) NT, c) NT of =P. peleus; d) E. talaus stat. rest. NT & LT of =Ph. serenus; e, f) E. guyaneus sp. n.: e) HT, f) PT; g) E. lina sp. n. HT; h) E. colombeus sp. n. HT; i) E. proxemus sp. n. HT; j, k) E. peruveus sp. n.: j) PT, k) HT; l) E. hyponota sp. n. HT; m) E. guato sp. n. HT; n) E. pano sp. n. HT; o, p) E. venezuelius sp. n.: o) HT, p) PT; q) E. ecuadius sp. n. HT; r) E. bogoteus sp. n. HT.