Telegonus ( Rhabdoides ) missionus Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16644487 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B2E-725A-FEE5-FF6EAA2CFE67 |
|
treatment provided by |
Felipe |
|
scientific name |
Telegonus ( Rhabdoides ) missionus Grishin |
| status |
new species |
Telegonus ( Rhabdoides) missionus Grishin , new species
http://zoobank.org/ BCC4198A-DEBB-48F6-8713-4FECEEF105C9
( Figs. 61 View Fig part, 64, 89 part)
Definition and diagnosis. Genomic analysis reveals that a specimen from the lower Río Grande Valley in Texas, USA, identified as Telegonus hopfferi ( Plötz, 1881) (type locality in Mexico, likely south-central or southern, lectotype sequenced as NVG-22068G07) is genetically differentiated from it at the species level ( Fig. 61 View Fig ); e.g., their COI barcodes differ by 1.7% (11 bp), which is the same as the difference between T. hopfferi and Telegonus alector (C. Felder & R. Felder, 1867) (type locality Colombia: Bogota). This new species keys to “ Astraptes alector hopfferi ” C.14.26(a) in Evans (1952) but differs from it by being darker beneath, with a smaller ventral forewing pale tornal area that is overscaled with brown and does not reach the discal cell, reduced pale overscaling along the forewing costa typical of T. hopfferi , and a basal white triangle on the ventral hindwing that is partly overscaled with brown and with a less sharp and more diffuse edge separating it from the brown ground color. Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.37.7:A72C, aly671.37.7:T75C, aly3512.7.2:T60C, aly172. 6.16:T36C, aly29286.1.3:G96A, aly60.18.6:C48C (not T), aly412.4.19:G108G (not A), aly216.44.7:C159C (not T), aly390.23.3:G60G (not C), aly378.37.11:G96G (not C); and COI barcode: A43T, T85C, C271T, A289G, A322A, A466G, T646T.
Barcode sequence of the holotype. Sample NVG-14111E04, GenBank PV550011, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCCGGATCTTTAATTGGAGATGATCAAATTTACAATACT ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCATTAACTTTATTGATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGACTTAGCAATTTTCTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATCACAACAATTATTAATATGCGAATTAATAGTTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATCACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT
Type material. Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA ( TAMU), illustrated in Fig. 64 View Fig , bears the following five printed (text in italics handwritten) rectangular labels, four white: [ TEXAS: | HIDALGO COUNTY | city of Mission | 10th Street at | irrigation ditch], [coll. | 29 OCT 1971 | Michael A. Rickard], [ HESPERIIDAE , | Pyrginae : | Astraptes alector | hopfferi (Plotz, 1882) | det. R.O. Kendall | ♀ (?) M. & B. No. 37], [DNA sample ID: | NVG-14111E04 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | missionus Grishin] . The end of the abdomen of the holotype was probably lost early on, which resulted in Kendall’s questionable determination of its sex (as labeled). The holotype appears to be a male, judging from its more elongated and pointed wings and the lack of white (or at least paler) scaling in the middle of the dorsal forewing characteristic of females in this species group.
Type locality. USA: Texas, Hidalgo Co., Mission, 10 th Street at irrigation ditch.
Etymology. The name is given for the type locality in Mission, Texas, and is treated as a masculine noun in apposition.
Distribution. Currently known only from the holotype collected in the lower Río Grande Valley of Texas, USA.
Suggested English name. Mission’s Flasher.
Comment. The type locality of this species is also the type locality of Spicauda atelis Grishin, 2023, and it may have been around GPS 26.2168, −98.3311.
| TAMU |
Texas A&M University |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Eudamini |
|
Genus |
