Telegonus (Rhabdoides) panamus Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16806315 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B0F-727A-FE1A-FD78AA59FCE8 |
|
treatment provided by |
Felipe |
|
scientific name |
Telegonus (Rhabdoides) panamus Grishin |
| status |
new species |
Telegonus (Rhabdoides) panamus Grishin , new species
http://zoobank.org/ 84351388-A1AB-48A1-82ED-169F7C16CD10 ( Figs. 61 View Fig part, 84, 85a–g, 89 part)
Definition and diagnosis. Inspection of genomic trees reveals that specimens from Panama forming a clade sister to Telegonus parmenides ( Stoll, 1781) , stat. rest. (type locality not stated in the description, likely in Suriname) are genetically differentiated from it at the species level ( Fig. 61 View Fig ); e.g., their COI barcodes differ by 2.4% (16 bp) and, therefore, represent a new species. This new species keys (incompletely) to “ Astraptes creteus creteus ” C.14.28(d) in Evans (1952), who treated T. parmenides as a junior subjective synonym of Telegonus creteus (Cramer, 1780) ( Suriname), and differs from these species by brilliantly blue (somewhat towards purple away from the wing bases in the holotype) or aquamarine (but not green) basal wing areas and body above, more restricted on the hindwing (not reaching its middle); dark ventral forewing costal area with more limited blue overscaling at the base; tornal pale area on the ventral forewing typically smaller and stronger overscaled with brown on the sides without a clearly outlined edge; a slightly narrower ampulla, and a more pointed and extended distal end of the harpe, which, as a result, is stronger concave at the dorsoposterior margin closer to its distal end ( Fig. 85a, f, g View Fig ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly535.10.1:G159A, aly535.10.1:A209G, aly2012.50.1:T78A, aly2012.50.1:A96C, aly638.4.4:C1161T; and COI barcode: T4C, C82T, T197C, T364A, T385C.
Barcode sequence of the holotype. Sample NVG-14111C10, GenBank PV550029, 658 base pairs:
AACCCTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACT ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCTTTAATAATAGGAGCCCCTGATATAGCTTTTCCACGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC ACATCAAGGAGCATCAGTTGACTTAGCAATTTTTTCTTTACACCTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT CATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 84 View Fig (genitalia Fig. 85a, b View Fig ), bears the following five printed (text in italics handprinted) rectangular labels, four white: [ PANAMA CANAL ZONE: | Barro Colorado Is. | 27 JULY 1977. | Silberglied/Aiello | AT LIGHTS], [DNA sample ID: | NVG-14111C10 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119F02 | c/o Nick V. Grishin ], [genitalia: | NVG240817-53 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | panamus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1♂ NVG-23063F12 Panama, Panamá Province, Summit, 2-Sep-1977, R. Hesterberg leg., genitalia vial SRS-1051 ( Fig. 85c–g View Fig ) [ MGCL] .
Type locality. Panama: Panamá Oeste Province , Barro Colorado Island.
Etymology. The name is derived from the name of the country with the type locality and is treated as a masculine noun in apposition.
Distribution. Currently known only from central Panama.
| USNM |
Smithsonian Institution, National Museum of Natural History |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Eudamini |
|
Genus |
