Nematovomycetes Tedersoo & Esmaeilzadeh-Salestani

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Nematovomycetes Tedersoo & Esmaeilzadeh-Salestani class. nov.

Type order.

Nematovomycetales Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 127–146 in N. soinasteënsis and S. cerevisiae : atccggyaggtatacctatt or gcctgcaggtatacctattt or acgtgcaagtatacctattt or atccaaagagtatacttgtt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Nematovomycota, covering sequences EUK 1217270 , EUK 1137920 , EUK 1124402 , EUK 1124400 , AB 971072, EUK 1106088 , OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016 , EUK 1107129 , EUK 1102228 , EUK 1204135 , EUK 1124398 , EUK 1124395 , EUK 1124396 , EUK 1200775 , and EUK 1124397 (Fig. 1 ).

Notes.

Nematovomycetes currently harbors Nematovomycetales (ord. nov.) and a potentially order-level group represented by the sequence EUK 1217270 (lake sediment in Portugal).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.