Pantelleria saittana Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Pantelleria saittana Tedersoo sp. nov.

Diagnosis.

Separation from other species of Pantelleria based on ITS 2 (positions 131–155 tttacatctttttctaaacttaatc; one mismatch allowed) and LSU D 2 (positions 722–741 aagagtgatggtgatcaagt; one mismatch allowed) as indicated in Fig. 3 . Intraspecific variation up to 3.8 % in ITS 2 and up to 1.5 % in LSU. Interspecific distance at least 10.1 % in ITS 2.

Type.

Vouchered soil sample TUE 000518 ( holotype); eDNA sequence EUK 1200019 = OZ 253786 ( legitype); eDNA sample TUE 100518 ( nucleotype); GSMc plot G 3487, Quercus ilex forest soil in Ponta Spadillo , Pantelleria , Italy, 36.8185°N, 12.0149°E .

Description.

Other sequences: OW 839340 and OW 840352 (unspecified soil in Tianshan Mountains, Uyghur Autonomous Region, China); EUK 1138064 ( GSMc plot G 4627, mixed forest soil in Tudusoo, Estonia, 59.11368°N, 26.75944°E); EUK 1120811 ( GSMc plot S 281, Quercus robur alley soil in Tartu, Estonia, 58.379°N, 26.706°E); EUK 0348125 (urban park soil in Niort, France, 46.325, – 0.4672°E); MH 625427 (microcosm soil in New Zealand); and MF 484888 (unspecified soil in Great Britain).

Etymology.

> Pantelleria (Maltese) refers to the type locality, and Saitta (Sicilian) refers to Alessandro Saitta, who collected material from the type locality.

Notes.

Found in soil samples and occasionally in oceanic sediments in temperate and subtropical regions worldwide (n = 18 records). The 86 GlobalFungi records confirm global soil distribution.

Figures

Figure 3. Diagnostic nucleotide sequences of Pantelleria saittana relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).