Panchrysia longcanggouensis, Hu, Yan-Qing, Huang, Zhen-Fu & Wang, Min, 2017

Hu, Yan-Qing, Huang, Zhen-Fu & Wang, Min, 2017, Taxonomy and geographical distribution of Panchrysia Hübner, [1821] of China, with description of a new species (Lepidoptera, Noctuidae, Plusiinae), Zootaxa 4238 (2), pp. 263-267 : 263-266

Panchrysia longcanggouensis sp. nov. ( Figs 1–4 )

Materials Examined. Holotype. Male , Longcanggou , Yingjing county , Sichuan, 18.VI.2016, Min Wang. The type specimens is deposited in the collection of Southwest University of Science and Technology ( SWUST), Mianyang, China.

Diagnosis. Externally, P. longcanggouensis is very closing to P. marmorea except the more zigzaged subterminal line in new species ( Figs 1 a & 5a). However, their genitalia cannot be confused: in male genitalia, valva dilated, harpe curved and shrinked medially and vesica with a robust cornutus medially and a plate-shaped cornuti field basally in new species ( Figs 2–4 ), while valva narrower, harpe more straight and vesica with a striped cornuti field basally in P. marmorea ( Figs 6–8 ).

Description. Adult ( Fig. 1 ). Wingspan 37 mm. Head reddish brown, collar reddish brown with whitish upper margin, antennae filiform. Thorax covered with long and brown hairs. Forewing ground color pinkish grey with more or less brown; basal line brown and simple, a brown and increasingly narrower stripe from costa to inner margin on the outside of basal line; antemedial line brown, double, waved, defined after discal cell; orbicular spot brown and similar quadrangular, claviform spot brown and semicircular, reniform spot brown and elliptic; medial line blackish brown with a brown shadow diffused on both side; postmedial line brown with the double line after M2 vein; subterminal line sinuous with brown shadow on inner side after M2 vein; terminal line dark brown shadow from costa to Cu1 vein. Hind wing ground colour pale brown with striped shadow. Male genitalia ( Figs 2–4 ): Uncus medium long, slender, pointed at apex; tegumen wide and short; valva broaden with dense hairs; cucullus round; saccullus and costa narrow; harpe slender, curved, shrinked medially and round at apex; juxta sclerotized along margin; saccus small, V-shaped. Aedeagus medium long; vesica slender with a cornuti field basally and a robust cornutus medially.

Distribution. China (Sichuan).

Etymology. The specific name is derived from the locality of holotype.

Molecular analysis. Barcodes were obtained for the P. longcanggouensis and P. marmoreal , 49 out of 658 bp (7.4%) are different between these two species. Hebert et al. (2003) reported that the genetic distance for COI between species in Lepidoptera are usually greater than 3%. Obviously, the barcode divergences based on the Kimura twoparameter distance between P. longcanggouensis and P. marnorea (7.4%) is greater than 3%. It is suggesting that the molecular results consistent with the morphological studies and P. longcanggouensis is a good species. DNA sequencing of the barcode fragment of the mitochondrial gene cytochrome oxidase 1 ( COI) was carried out at the South China Agricultural University in Guangzhou , China. The protocol for DNA extraction and PCR (Ploymerase Chain Reaction) amplification is refer to Huang et al. (2016). The COI DNA Barcodes of the two species are as follow.

P. longcanggouensis :

AACTCTATACTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACATCTTTAAGATTATT AATTCGAGCAGAATTAGGTACCCCTGGATCATTAATCGGAGATGACCAAATTTATAATAC TATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGG AGGATTTGGTAATTGACTTGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCG AATAAATAATATAAGTTTTTGACTTCTTCCCCCATCATTAACTTTATTAATTTCTAGAAG AATTGTAGAAAATGGGGCAGGAACAGGATGAACTGTTTACCCCCCACTTTCATCCAATAT TGCCCATAGTGGAAGTTCTGTCGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTC CTCAATTTTAGGAGCGATTAATTTTATTACTACAATTATTAATATACGATTAAATAGTCT ATCTTTTGATCAAATACCTTTATTCATTTGAGCTGTAGGAATTACTGCTTTCTTATTATT ACTTTCTTTACCTGTTTTAGCAGGAGCAATTACTATACTTTTAACAGATCGTAATTTAAA TACTTCTTTTTTTGACCCTGCAGGAGGAGGAGATCCTATTTTATACCAACACTTATTT P. marnorea :

AACTCTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGGACATCATTAAGATTACT AATTCGTGCAGAATTAGGAACTCCCGGATCTTTAATTGGAGATGATCAAATTTATAATAC TATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGG AGGATTTGGTAATTGACTTATCCCTTTAATATTAGGGGCCCCTGATATAGCTTTCCCTCG TTTAAATAATATAAGTTTTTGACTTCTTCCCCCCTCATTAACTTTACTAATTTCTAGAAG AATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATAT TGCTCATGGGGGAAGTTCTGTAGACTTAGCTATCTTTTCCCTACACTTAGCTGGTATCTC CTCAATTTTAGGTGCAATTAACTTTATCACTACAATTATTAATATACGATTAAATAATTT ATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCTTTTTTATTACT ACTTTCTTTACCTGTTTTAGCAGGTGCAATTACAATACTTTTAACAGATCGTAATTTAAA TACTTCTTTTTTTGATCCCGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Figures

FIGURES 1 – 14. 1 – 4. P. longcanggouensis sp. nov. 1. Male Adult (Holotype); 2 – 4. Male Genitalia (Holotype). 5 – 8. P. marmorea. 5. Male Adult; 6 – 8. Male Genitalia. 9 – 12. P. tibetensis. 9. Male Adult; 10 & 11. Male Genitalia; 12. Female Genitalia. 13. P. ornata, Male Adult (Illustration by Ronkay et al., 2008). 14. P. dives, Male Adult (Illustration by Ronkay et al., 2008). Scale bars = 0.5 mm.