Sumavosporidiales Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Sumavosporidiales Tedersoo & Esmaeilzadeh-Salestani ord. nov.

Type family.

Sumavosporidiaceae Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in SSU V 6 (positions 1157–1176 in S. cerevisiae acaccaaaagtggattttgc or acaccaagagtggagcatgc or acacaagaagtggagcctgc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Sumavosporidiomycetes, covering sequences EUK 1206927 , EUK 1202246 , EUK 1200658 , UDB 029033 , EUK 1105717 , EUK 1107386 , EUK 1106576 , EUK 1101061 , and EUK 1101529 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Currently includes Sumavosporidiaceae (fam. nov.) and several potentially family-level groups represented by sequences EUK 1206927 (marine sediment in Norway), EUK 1202246 (river sediment in Slovenia), EUK 1200658 (forest soil in Bulgaria), EUK 1101529 (forest soil in Sweden), EUK 1105717 (forest soil in Sweden), and EUK 1101061 (mixed soil in Tibet).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.