Edaphochytriales Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Edaphochytriales Tedersoo ord. nov.

Type family.

Edaphochytriaceae Tedersoo .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 45–64 catagtgaaatgtgataact in type species and S. cerevisiae ; no mismatch allowed). Forms a monophyletic, least inclusive clade in Edaphochytriomycetes, covering sequences EUK 1671450 , EUK 1671451 , EUK 1008462 , EUK 1200051 , EUK 1101631 , EUK 1101779 , EUK 1123746 , EUK 1200763 , and EUK 1123748 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Currently includes Edaphochytriaceae (fam. nov.) and other potentially family-level groups represented by sequences EUK 1671450 (forest soil in Guadeloupe), EUK 1101631 (permafrost in Canada), EUK 1101779 (cropland soil in Great Britain), and EUK 1671451 (shrubland soil in Morocco).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.