Thinophilus lungosetole Ramos & Grootaert, 2018

Ramos, Kay, Meier, Rudolf, Nuneza, Olga & Grootaert, Patrick, 2018, Two new species of mangrove Dolichopodidae from Bohol Island in the Philippines (Insecta: Diptera) and a checklist of the Dolichopodidae of the Philippines, Raffles Bulletin of Zoology 66, pp. 268-276 : 269-271

Thinophilus lungosetole Ramos & Grootaert sp. nov.

( Figs. 1–3 )

Type material. Holotype male: PHILIPPINES, Bohol, SAVIMA mangrove. MT1 1♂, 9.727948°N, 123.849755°E; 2 July 2016; (BohSW1 T5 _F32_ R61 ).

Paratype: 1♀, same locality as holotype but different date: 25 June 2016; (BohSW1 T4 _ F32_ R64 ) (kp_PHI_doli_C22_ R64 _000064_Z4.0_ 65mm _L) .

Etymology. The name of this species derives from the Italian lungo, long and setole, bristles, referring to the long ventral bristles on the fore tibia.

Extended diagnosis. Small species (body 3.2 mm; wing 2.7 mm) with yellow antenna, postpedicel rounded, higher than long. Thorax with 4 long dorsocentrals (dc), all equally long. Propleurals pale brown, not very long. Legs yellow including all tarsomeres. Fore coxa yellow, but posterior four coxae black. Fore femur with only minute ventral bristles. Fore tibia with a single row of at least 12 very long ventral bristles, longest near middle, there they are four times as long as the tibia is wide, becoming shorter toward apex ( Fig. 1 ). A row of long posteroventral bristles on tarsomere 1, 2, 3 and 4. Longest on tarsomere 1, twice as long as tarsomere is wide. Tarsomere 2, 3 and 4 with a fine, subapical bristle. Mid femur with a double row of short ventral bristles, a few bristles in basal third longer but hardly half as long as femur is wide. Hind femur with a row of short ventral bristles, hardly half as long as femur is wide except for about 3 bristles in second basal quarter that are nearly as long as femur is wide. Wing brownish tinged with brown veins. Hypopygium and cercus small, pale yellow ( Fig. 3 ). Cerci separated ( Fig. 3C ) with long yellow apical bristles. Phallus long ( Fig. 3B ).

Female similar to male but lacking the long ventral bristles on the fore tibia ( Fig. 2 ).

Remarks. The present new species is unique in having only short ventral bristles on the fore femur combined with long ventral bristles on the fore tibia, that are nearly four times as long as tibia is wide. No other Thinophilus from Southeast Asia combine these characters.

NGS barcodes. The NGS Barcodes of the male and female specimens with codes BohSW1T4_F32_R64 clustered with BohSW2T5_F32_R61 are shown in Table 3.

Specimen DNA Sequence (313bp)

kp_doli_ Thinophilus ronazeli sp. nov. _COI_ tctatcctcaggaattgcccatggaggagcctctgtagatttagcaattttttctcttcatttagcaggagtatcctcaattctaggg PHI_BohSW11T1_Mangrove_P1_03Sep16_ gcagttaattttattacaactgttattaatatgcgttcaacaggaattacatttgaccgaatacctttatttgtatgatcagttgtaatta F32_R79 cagcaattctattattattatctctaccagtactagcaggagcaatcactatactactaaccgatcgaaaccttaatacttcatttttc gacccagccggaggtggagaccctatcttatatcaacacctattt--

kp_doli_ Thinophilus ronazeli sp. nov. _COI_ tctatcctcaggaattgcccatggaggagcctctgtagatttagcaattttttctcttcatttagcaggagtatcctcaattctagggg PHI_BohSW1T4_Mangrove_P1_25Jun16_ cagttaattttattacaactgttattaatatgcgttcaacaggaattacatttgaccgaatacctttatttgtatgatcagttgtaattaca F32_R62 gcaattctattattattatctctaccagtactagcaggagcaatcactatactactaaccgatcgaaaccttaatacttcatttttcgac ccagccggaggtggagaccctatcttatatcaacacctattt---

kp_doli_ Thinophilus ronazeli sp. nov. _COI_ tctatcctcaggaattgcccatggaggagcctctgtagatttagcaattttttctcttcatttagcaggagtatcctcaattctagggg PHI_BohSW3T5_Mangrove_P1_09Jul16_ cagttaattttattacaactgttattaatatgcgttcaacaggaattacatttgaccgaatacctttatttgtatgatcagttgtaattaca F32_R71 gcaattctattattattatctctaccagtactagcaggagcaatcactatactactaaccgatcgaaaccttaatacttcatttttcgac ccagccggaggtggagaccctatcttatatcaacacctattt---

Figures

Fig. 1. Thinophilus lungosetole Ramos & Grootaert sp. nov. Holotype male. Habitus, lateral view.

Fig.2.Thinophilus lungosetole Ramos & Grootaert sp.nov. Paratype female. Habitus, lateral view.

Fig. 3. Thinophilus lungosetole Ramos & Grootaert sp. nov. Holotype male terminalia. A. genital capsule, ventral view; B. genital capsule, lateral view; C. genital capsule, dorsal view. C: cercus; Ph: phallus; Sur: surstylus.