Tibetochytrium Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Tibetochytrium Tedersoo gen. nov.

Type species.

Tibetochytrium taylorii Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 100–119 in type species ttgacagacttacgcgtctt; two mismatches allowed), LSU D 2 (positions 552–571 in type species and 547–566 in S. cerevisiae aaagtgttatagcttttcat; two mismatches allowed), and SSU V 9 (positions 1700–1714 in S. cerevisiae caacgaaaatagatt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tibetochytriaceae, covering sequences EUK 1123755 and EUK 1186750 (Figs 1 , 10 ).

Notes.

Recognized based on eDNA sequences only. Comprises a single species, Tibetochytrium taylorii (sp. nov.).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.

Figure 10. Maximum Likelihood SSU- ITS - LSU phylogram indicating the position of Tibetochytrium taylorii within Tibetochytriomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Chytridiomycota spp. were used as an outgroup.